Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7822Btlr/Mmmh
Stock Number:
045876-MU
Citation ID:
RRID:MMRRC_045876-MU
Other Names:
R7822 (G1)
Major Collection:

Strain Information

Ntsr1
Name: neurotensin receptor 1
Synonyms: NT-1R, Ntsr1, NTR-1, NTR1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18216
HGNC: HGNC:8039
Homologene: 68261
Evl
Name: Ena-vasodilator stimulated phosphoprotein
Synonyms: b2b2600Clo
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 14026
VEGA: 12
Homologene: 56752
Mast2
Name: microtubule associated serine/threonine kinase 2
Synonyms: MAST205, Mtssk
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 17776
Homologene: 7428
Nisch
Name: nischarin
Synonyms: 1200007D05Rik, 3202002H23Rik, edsn
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 64652
Homologene: 136161
Mycbp2
Name: MYC binding protein 2, E3 ubiquitin protein ligase
Synonyms: Pam, C130061D10Rik, Phr1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 105689
Homologene: 9005
Arhgap21
Name: Rho GTPase activating protein 21
Synonyms: 5530401C11Rik, ARHGAP10
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71435
Homologene: 10822
Psme4
Name: proteasome (prosome, macropain) activator subunit 4
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 103554
Homologene: 113742
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to A, chromosome 1 at 75,146,541 bp
  • C to T, chromosome 1 at 107,606,993 bp
  • A to G, chromosome 1 at 186,749,176 bp
  • G to A, chromosome 2 at 20,880,713 bp
  • A to T, chromosome 2 at 27,282,287 bp
  • A to G, chromosome 2 at 76,779,433 bp
  • A to C, chromosome 2 at 88,323,081 bp
  • G to A, chromosome 2 at 121,103,940 bp
  • G to T, chromosome 2 at 121,377,738 bp
  • A to G, chromosome 2 at 130,041,899 bp
  • G to T, chromosome 2 at 151,655,125 bp
  • A to T, chromosome 2 at 153,810,912 bp
  • CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT to CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT, chromosome 2 at 164,499,669 bp
  • T to C, chromosome 2 at 164,839,232 bp
  • A to T, chromosome 2 at 164,949,036 bp
  • T to C, chromosome 2 at 180,538,690 bp
  • G to A, chromosome 3 at 32,596,331 bp
  • T to C, chromosome 3 at 89,007,264 bp
  • C to T, chromosome 3 at 115,899,750 bp
  • T to C, chromosome 4 at 100,441,367 bp
  • A to G, chromosome 4 at 116,312,873 bp
  • T to C, chromosome 4 at 125,656,397 bp
  • C to A, chromosome 4 at 133,498,039 bp
  • T to A, chromosome 5 at 33,843,594 bp
  • A to T, chromosome 5 at 37,175,180 bp
  • C to T, chromosome 5 at 108,080,877 bp
  • A to G, chromosome 5 at 121,407,213 bp
  • T to C, chromosome 6 at 28,418,786 bp
  • T to C, chromosome 6 at 42,247,752 bp
  • T to C, chromosome 6 at 42,629,099 bp
  • A to G, chromosome 6 at 91,018,777 bp
  • T to A, chromosome 6 at 136,708,406 bp
  • T to C, chromosome 7 at 24,229,145 bp
  • A to G, chromosome 7 at 24,503,545 bp
  • T to C, chromosome 7 at 72,127,187 bp
  • A to T, chromosome 8 at 15,108,454 bp
  • T to C, chromosome 8 at 63,927,284 bp
  • T to C, chromosome 8 at 84,261,782 bp
  • T to C, chromosome 8 at 104,251,097 bp
  • T to C, chromosome 8 at 119,454,364 bp
  • C to A, chromosome 9 at 101,027,084 bp
  • G to A, chromosome 10 at 22,664,669 bp
  • A to G, chromosome 10 at 44,458,482 bp
  • A to G, chromosome 10 at 128,942,966 bp
  • A to T, chromosome 11 at 21,333,762 bp
  • A to G, chromosome 11 at 30,874,245 bp
  • A to G, chromosome 11 at 35,819,966 bp
  • A to G, chromosome 11 at 46,404,903 bp
  • C to T, chromosome 11 at 60,462,200 bp
  • A to G, chromosome 11 at 100,104,140 bp
  • TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC to TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC, chromosome 11 at 100,189,077 bp
  • T to C, chromosome 12 at 108,648,464 bp
  • T to A, chromosome 13 at 21,369,204 bp
  • T to A, chromosome 13 at 22,502,071 bp
  • A to C, chromosome 13 at 60,725,901 bp
  • A to T, chromosome 13 at 112,612,113 bp
  • C to G, chromosome 14 at 31,174,651 bp
  • C to T, chromosome 14 at 54,917,450 bp
  • G to C, chromosome 14 at 61,192,203 bp
  • T to G, chromosome 14 at 103,139,415 bp
  • T to C, chromosome 15 at 3,457,957 bp
  • T to A, chromosome 15 at 5,098,865 bp
  • A to C, chromosome 15 at 84,765,732 bp
  • T to C, chromosome 16 at 10,382,928 bp
  • G to A, chromosome 16 at 70,433,612 bp
  • T to C, chromosome 16 at 73,973,171 bp
  • C to A, chromosome 17 at 29,319,234 bp
  • T to A, chromosome 17 at 34,363,314 bp
  • T to A, chromosome 17 at 37,467,103 bp
  • G to T, chromosome 18 at 16,624,284 bp
  • G to T, chromosome 18 at 67,641,149 bp
  • T to A, chromosome 19 at 13,103,053 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7822 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045876-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.