Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7825Btlr/Mmmh
Stock Number:
045879-MU
Citation ID:
RRID:MMRRC_045879-MU
Other Names:
R7825 (G1)
Major Collection:

Strain Information

Atp1a1
Name: ATPase, Na+/K+ transporting, alpha 1 polypeptide
Synonyms: Atpa-1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 11928
HGNC: HGNC:799
Homologene: 564
Clasp1
Name: CLIP associating protein 1
Synonyms: 5730583A19Rik, 1700030C23Rik, mCLASP1, CLASP1alpha, CLASP1, B130045P17Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 76707
Homologene: 41024
Ambra1
Name: autophagy/beclin 1 regulator 1
Synonyms: 2310079H06Rik, D030051N19Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228361
Homologene: 18204
Zfat
Name: zinc finger and AT hook domain containing
Synonyms: LOC380993, Zfp406, Zfat1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 380993
Homologene: 16829
Prcc
Name: papillary renal cell carcinoma (translocation-associated)
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 94315
HGNC: HGNC:9343
Homologene: 38120
Eif3e
Name: eukaryotic translation initiation factor 3, subunit E
Synonyms: eIF3-p48, eIF3-p46, Int6, 48kDa, Eif3s6
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 16341
VEGA: 15
HGNC: HGNC:3277
Homologene: 1205
Phc1
Name: polyhomeotic 1
Synonyms: Rae-28, Mph1, rae28, Edr1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 13619
HGNC: HGNC:3182
Homologene: 107079
Stat1
Name: signal transducer and activator of transcription 1
Synonyms: 2010005J02Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 20846
Homologene: 21428
Rsf1
Name: remodeling and spacing factor 1
Synonyms: p325, XAP8, Hbxap, C030033M12Rik, 4832420A03Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233532
Homologene: 41142
Ncor2
Name: nuclear receptor co-repressor 2
Synonyms: SMRTe, SMRT
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20602
HGNC: HGNC:7673
Homologene: 31370
Tep1
Name: telomerase associated protein 1
Synonyms: Tp1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 21745
VEGA: 14
Homologene: 5157
Tiam1
Name: T cell lymphoma invasion and metastasis 1
Synonyms: D16Ium10, D16Ium10e
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 21844
Homologene: 2443
Wwc2
Name: WW, C2 and coiled-coil domain containing 2
Synonyms: D8Ertd594e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 52357
Homologene: 32618
Polr1b
Name: polymerase (RNA) I polypeptide B
Synonyms: RPA2, RPA116, 128kDa, D630020H17Rik, Rpo1-2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20017
Homologene: 7133
Ntng2
Name: netrin G2
Synonyms: Lmnt2, 2610016D08Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 171171
Homologene: 13053
Ube3b
Name: ubiquitin protein ligase E3B
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 117146
Homologene: 13775
Thra
Name: thyroid hormone receptor alpha
Synonyms: T3Ralpha, T3R[a], Nr1a1, TR alpha 1, c-erbAalpha, Erba, TR alpha 2, 6430529J03Rik, Rvr, Thra2, Thra1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 21833
Homologene: 37747
Themis
Name: thymocyte selection associated
Synonyms: E430004N04Rik, Tsepa, Gasp
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 210757
Homologene: 72287
Treml1
Name: triggering receptor expressed on myeloid cells-like 1
Synonyms: TLT-1, 5430401J17Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 71326
VEGA: 17
Homologene: 52257
Hspg2
Name: perlecan (heparan sulfate proteoglycan 2)
Synonyms: per, Pcn, Plc, perlecan
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 15530
HGNC: HGNC:5273
Homologene: 68473
Nipbl
Name: NIPBL cohesin loading factor
Synonyms: 4921518A06Rik, 4933421G18Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 71175
VEGA: 15
Homologene: 15850
Nav1
Name: neuron navigator 1
Synonyms: POMFIL3, 9930003A20Rik, C230080M11Rik, unc53H1, steerin-1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 215690
Homologene: 10719
Gtf3c2
Name: general transcription factor IIIC, polypeptide 2, beta
Synonyms: 2610510G03Rik, TFIIIC-BETA, TFIIIC110, 1300004C11Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 71752
HGNC: HGNC:4665
Homologene: 37490
Gpatch8
Name: G patch domain containing 8
Synonyms: 5430405G24Rik, Gpatc8, ENSMUSG00000075516, Fbm1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237943
Homologene: 46117
Smpd3
Name: sphingomyelin phosphodiesterase 3, neutral
Synonyms: neutral sphingomyelinase II, nSMase2, 4631433G07Rik, fro, Nsm2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 58994
Homologene: 10260
Cmya5
Name: cardiomyopathy associated 5
Synonyms: Myospryn, 2310076E16Rik, 2310076E21Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 76469
VEGA: 13
Homologene: 137367
Tesk1
Name: testis specific protein kinase 1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 21754
Homologene: 4577
Myh8
Name: myosin, heavy polypeptide 8, skeletal muscle, perinatal
Synonyms: MyHC-pn, Myhs-p, Myhsp, 4832426G23Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17885
HGNC: HGNC:7578
Homologene: 68256
Ttc39d
Name: tetratricopeptide repeat domain 39D
Synonyms: 4930560E09Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 67737
Homologene: 65053
Slc15a2
Name: solute carrier family 15 (H+/peptide transporter), member 2
Synonyms: Pept2, 8430408C16Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 57738
Homologene: 56912
Krt76
Name: keratin 76
Synonyms: 2310001L23Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 77055
Homologene: 22931
Cpeb2
Name: cytoplasmic polyadenylation element binding protein 2
Synonyms: A630055H10Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231207
Homologene: 17995
Kcnb1
Name: potassium voltage gated channel, Shab-related subfamily, member 1
Synonyms: Kv2.1, Kcr1-1, Shab
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16500
HGNC: HGNC:6231
Homologene: 37988
Adprs
Name: ADP-ribosylserine hydrolase
Synonyms: Arh3, Adprhl2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100206
Homologene: 9863
Serpina11
Name: serine (or cysteine) peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 11
Synonyms: LOC380780
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 380780
Homologene: 28490
Tmc1
Name: transmembrane channel-like gene family 1
Synonyms: Bth, Beethoven, 4933416G09Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 13409
VEGA: 19
Homologene: 23670
Krt16
Name: keratin 16
Synonyms: K16, Krt1-16
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16666
HGNC: HGNC:6423
Homologene: 21145
Ifi202b
Name: interferon activated gene 202B
Synonyms: p202
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 26388
Sgk2
Name: serum/glucocorticoid regulated kinase 2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 27219
Homologene: 8446
Vmn1r35
Name: vomeronasal 1 receptor 35
Synonyms: V1rc12
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 171185
Homologene: 110800
Ttll3
Name: tubulin tyrosine ligase-like family, member 3
Synonyms: 4833441J24Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 101100
Homologene: 134361
Fam186b
Name: family with sequence similarity 186, member B
Synonyms: EG545136
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 545136
VEGA: 15
Homologene: 69502
Akp3
Name: alkaline phosphatase 3, intestine, not Mn requiring
Synonyms: IAP, Akp-3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 11648
Homologene: 134333
Cyp2f2
Name: cytochrome P450, family 2, subfamily f, polypeptide 2
Synonyms: Cyp2f
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13107
Homologene: 73898
Gnmt
Name: glycine N-methyltransferase
Synonyms: glycine N methyl transferase
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 14711
HGNC: HGNC:4415
Homologene: 7741
Cd38
Name: CD38 antigen
Synonyms: Cd38-rs1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12494
HGNC: HGNC:1667
Homologene: 1345
1700013G24Rik
Name: RIKEN cDNA 1700013G24 gene
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 69380
Homologene: 124477
Ephb4
Name: Eph receptor B4
Synonyms: MDK2, Myk1, Htk, Tyro11, b2b2412Clo
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 13846
HGNC: HGNC:3395
Homologene: 20939
Ston1
Name: stonin 1
Synonyms: 4921524J06Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 77057
Homologene: 122152
Dcst1
Name: DC-STAMP domain containing 1
Synonyms: A330106H01Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 77772
Homologene: 14981
Hepacam
Name: hepatocyte cell adhesion molecule
Synonyms: 2900042E01Rik, Glialcam
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 72927
Homologene: 17652
Zfp40
Name: zinc finger protein 40
Synonyms: NTfin12, Zfp-40
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 22700
Homologene: 136312
Prss27
Name: serine protease 27
Synonyms: marapsin, CAPH2, Mpn, Pancreasin
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 213171
Homologene: 23743
Pcdhga4
Name: protocadherin gamma subfamily A, 4
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93712
HGNC: HGNC:8702
Homologene: 81866
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 52,151,308 bp
  • TCACCACCACCACCACCACCACCACCACCAC to TCACCACCACCACCACCACCACCACCAC, chromosome 1 at 87,127,767 bp
  • T to C, chromosome 1 at 118,545,393 bp
  • A to T, chromosome 1 at 135,450,044 bp
  • A to C, chromosome 1 at 173,975,050 bp
  • T to A, chromosome 2 at 29,204,078 bp
  • A to G, chromosome 2 at 91,767,761 bp
  • C to A, chromosome 2 at 129,125,544 bp
  • G to T, chromosome 2 at 163,006,881 bp
  • A to T, chromosome 2 at 167,105,972 bp
  • T to A, chromosome 3 at 87,869,745 bp
  • A to G, chromosome 3 at 89,352,821 bp
  • T to C, chromosome 3 at 101,586,169 bp
  • A to C, chromosome 4 at 43,447,143 bp
  • C to A, chromosome 4 at 126,321,696 bp
  • C to T, chromosome 4 at 137,455,343 bp
  • T to A, chromosome 4 at 137,558,849 bp
  • T to C, chromosome 5 at 31,158,371 bp
  • A to T, chromosome 5 at 43,237,539 bp
  • A to T, chromosome 5 at 43,901,455 bp
  • T to A, chromosome 5 at 87,001,359 bp
  • T to A, chromosome 5 at 114,401,312 bp
  • T to C, chromosome 5 at 125,037,077 bp
  • T to C, chromosome 5 at 137,372,437 bp
  • A to T, chromosome 6 at 66,679,459 bp
  • CAAAGTAA to CAAAGTAAAGTAA, chromosome 6 at 113,399,157 bp
  • AAGTA to AAGTAGAGTA, chromosome 6 at 113,399,159 bp
  • T to C, chromosome 6 at 122,322,381 bp
  • G to A, chromosome 7 at 27,129,253 bp
  • G to GACGGCGGCC, chromosome 7 at 97,579,909 bp
  • A to G, chromosome 8 at 47,990,162 bp
  • A to C, chromosome 8 at 106,255,622 bp
  • T to C, chromosome 9 at 37,384,768 bp
  • A to G, chromosome 10 at 28,782,474 bp
  • A to T, chromosome 11 at 67,303,712 bp
  • G to A, chromosome 11 at 98,762,948 bp
  • T to A, chromosome 11 at 100,248,634 bp
  • A to C, chromosome 11 at 102,481,442 bp
  • T to C, chromosome 12 at 103,984,577 bp
  • G to T, chromosome 13 at 93,097,628 bp
  • T to C, chromosome 14 at 50,843,887 bp
  • T to A, chromosome 15 at 8,291,487 bp
  • A to C, chromosome 15 at 43,266,271 bp
  • T to C, chromosome 15 at 68,179,920 bp
  • T to C, chromosome 15 at 99,283,847 bp
  • T to A, chromosome 15 at 101,887,503 bp
  • C to T, chromosome 16 at 36,753,034 bp
  • A to T, chromosome 16 at 89,898,089 bp
  • T to C, chromosome 17 at 23,176,327 bp
  • T to C, chromosome 17 at 24,042,958 bp
  • T to C, chromosome 17 at 46,729,093 bp
  • C to A, chromosome 17 at 48,366,756 bp
  • A to G, chromosome 17 at 80,216,146 bp
  • T to C, chromosome 17 at 88,636,453 bp
  • T to A, chromosome 18 at 37,687,321 bp
  • T to C, chromosome 19 at 20,804,645 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7825 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045879-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.