Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7825Btlr/Mmmh
Stock Number:
045879-MU
Citation ID:
RRID:MMRRC_045879-MU
Other Names:
R7825 (G1)
Major Collection:

Strain Information

Atp1a1
Name: ATPase, Na+/K+ transporting, alpha 1 polypeptide
Synonyms: Atpa-1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 11928
HGNC: HGNC:799
Homologene: 564
Clasp1
Name: CLIP associating protein 1
Synonyms: 5730583A19Rik, 1700030C23Rik, mCLASP1, CLASP1alpha, CLASP1, B130045P17Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 76707
Homologene: 41024
Ambra1
Name: autophagy/beclin 1 regulator 1
Synonyms: 2310079H06Rik, D030051N19Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228361
Homologene: 18204
Zfat
Name: zinc finger and AT hook domain containing
Synonyms: LOC380993, Zfp406, Zfat1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 380993
Homologene: 16829
Prcc
Name: papillary renal cell carcinoma (translocation-associated)
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 94315
HGNC: HGNC:9343
Homologene: 38120
Eif3e
Name: eukaryotic translation initiation factor 3, subunit E
Synonyms: eIF3-p48, eIF3-p46, Int6, 48kDa, Eif3s6
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 16341
VEGA: 15
HGNC: HGNC:3277
Homologene: 1205
Phc1
Name: polyhomeotic 1
Synonyms: Rae-28, Mph1, rae28, Edr1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 13619
HGNC: HGNC:3182
Homologene: 107079
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 52,151,308 bp
  • TCACCACCACCACCACCACCACCACCACCAC to TCACCACCACCACCACCACCACCACCAC, chromosome 1 at 87,127,767 bp
  • T to C, chromosome 1 at 118,545,393 bp
  • A to T, chromosome 1 at 135,450,044 bp
  • A to C, chromosome 1 at 173,975,050 bp
  • T to A, chromosome 2 at 29,204,078 bp
  • A to G, chromosome 2 at 91,767,761 bp
  • C to A, chromosome 2 at 129,125,544 bp
  • G to T, chromosome 2 at 163,006,881 bp
  • A to T, chromosome 2 at 167,105,972 bp
  • T to A, chromosome 3 at 87,869,745 bp
  • A to G, chromosome 3 at 89,352,821 bp
  • T to C, chromosome 3 at 101,586,169 bp
  • A to C, chromosome 4 at 43,447,143 bp
  • C to A, chromosome 4 at 126,321,696 bp
  • C to T, chromosome 4 at 137,455,343 bp
  • T to A, chromosome 4 at 137,558,849 bp
  • T to C, chromosome 5 at 31,158,371 bp
  • A to T, chromosome 5 at 43,237,539 bp
  • A to T, chromosome 5 at 43,901,455 bp
  • T to A, chromosome 5 at 87,001,359 bp
  • T to A, chromosome 5 at 114,401,312 bp
  • T to C, chromosome 5 at 125,037,077 bp
  • T to C, chromosome 5 at 137,372,437 bp
  • A to T, chromosome 6 at 66,679,459 bp
  • CAAAGTAA to CAAAGTAAAGTAA, chromosome 6 at 113,399,157 bp
  • AAGTA to AAGTAGAGTA, chromosome 6 at 113,399,159 bp
  • T to C, chromosome 6 at 122,322,381 bp
  • G to A, chromosome 7 at 27,129,253 bp
  • G to GACGGCGGCC, chromosome 7 at 97,579,909 bp
  • A to G, chromosome 8 at 47,990,162 bp
  • A to C, chromosome 8 at 106,255,622 bp
  • T to C, chromosome 9 at 37,384,768 bp
  • A to G, chromosome 10 at 28,782,474 bp
  • A to T, chromosome 11 at 67,303,712 bp
  • G to A, chromosome 11 at 98,762,948 bp
  • T to A, chromosome 11 at 100,248,634 bp
  • A to C, chromosome 11 at 102,481,442 bp
  • T to C, chromosome 12 at 103,984,577 bp
  • G to T, chromosome 13 at 93,097,628 bp
  • T to C, chromosome 14 at 50,843,887 bp
  • T to A, chromosome 15 at 8,291,487 bp
  • A to C, chromosome 15 at 43,266,271 bp
  • T to C, chromosome 15 at 68,179,920 bp
  • T to C, chromosome 15 at 99,283,847 bp
  • T to A, chromosome 15 at 101,887,503 bp
  • C to T, chromosome 16 at 36,753,034 bp
  • A to T, chromosome 16 at 89,898,089 bp
  • T to C, chromosome 17 at 23,176,327 bp
  • T to C, chromosome 17 at 24,042,958 bp
  • T to C, chromosome 17 at 46,729,093 bp
  • C to A, chromosome 17 at 48,366,756 bp
  • A to G, chromosome 17 at 80,216,146 bp
  • T to C, chromosome 17 at 88,636,453 bp
  • T to A, chromosome 18 at 37,687,321 bp
  • T to C, chromosome 19 at 20,804,645 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7825 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045879-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.