Strain Name:
C57BL/6J-MtgxR7827Btlr/Mmmh
Stock Number:
045881-MU
Citation ID:
RRID:MMRRC_045881-MU
Other Names:
R7827 (G1)
Major Collection:

Strain Information

Adamts20
Name: ADAM metallopeptidase with thrombospondin type 1 motif 20
Synonyms: ADAMTS-20, bt
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223838
Homologene: 11808
Fam117b
Name: family with sequence similarity 117, member B
Synonyms: 6330416D14Rik, 2810425F24Rik, Als2cr13
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 72750
Homologene: 18307
Npy1r
Name: neuropeptide Y receptor Y1
Synonyms: Y1-R, Npyr
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 18166
HGNC: HGNC:7956
Homologene: 700
Abca12
Name: ATP-binding cassette, sub-family A member 12
Synonyms: 4832428G11Rik, 4833417A11Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74591
Homologene: 45441
U2af2
Name: U2 small nuclear ribonucleoprotein auxiliary factor (U2AF) 2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22185
Homologene: 110853
Pmpca
Name: peptidase (mitochondrial processing) alpha
Synonyms: INPP5E, Alpha-MPP, 4933435E07Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66865
Homologene: 6078
Lrrc2
Name: leucine rich repeat containing 2
Synonyms: 2400002D05Rik, 4933431K03Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74249
Homologene: 23454
En2
Name: engrailed 2
Synonyms: En-2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 13799
HGNC: HGNC:3343
Homologene: 55579
Carmil1
Name: capping protein regulator and myosin 1 linker 1
Synonyms: 1110037D04Rik, Lrrc16, Carmil, Lrrc16a
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 68732
Homologene: 9757
Ints3
Name: integrator complex subunit 3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229543
Homologene: 11309
Nup98
Name: nucleoporin 98
Synonyms: Nup96
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 269966
HGNC: HGNC:8068
Homologene: 35472
Hunk
Name: hormonally upregulated Neu-associated kinase
Synonyms: Mak-v, Bstk1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 26559
VEGA: 16
Homologene: 8742
Phip
Name: pleckstrin homology domain interacting protein
Synonyms: Wdr11, Ndrp, 2810004D21Rik, 4632404O06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 83946
Homologene: 41209
Bptf
Name: bromodomain PHD finger transcription factor
Synonyms: 9430093H17Rik, Falz
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 207165
HGNC: HGNC:3581
Homologene: 114397
Tbc1d5
Name: TBC1 domain family, member 5
Synonyms: 1600014N05Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 72238
VEGA: 17
Homologene: 8834
Ywhag
Name: tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide
Synonyms: 14-3-3 gamma, D7Bwg1348e
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22628
Homologene: 22725
Polr1b
Name: polymerase (RNA) I polypeptide B
Synonyms: RPA2, RPA116, 128kDa, D630020H17Rik, Rpo1-2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20017
Homologene: 7133
Gja8
Name: gap junction protein, alpha 8
Synonyms: Cnx50, connexin 50, alpha 8 connexin, Cx50, Aey5, Lop10, dcm
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 14616
HGNC: HGNC:4281
Homologene: 3857
Map3k1
Name: mitogen-activated protein kinase kinase kinase 1
Synonyms: MEKK1, Mekk
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 26401
HGNC: HGNC:6848
Homologene: 8056
Tmed8
Name: transmembrane p24 trafficking protein 8
Synonyms: 6430595O10Rik, Mem1, LOC382620
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 382620
VEGA: 12
Homologene: 19600
Strip2
Name: striatin interacting protein 2
Synonyms: D330017J20Rik, Fam40b, Myoscape
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 320609
Homologene: 66198
Rex2
Name: reduced expression 2
Synonyms: Gm13138
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100043034
Homologene: 133076
Muc16
Name: mucin 16
Synonyms: LOC385009, 1110008I14Rik, Gm21044
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 73732
Homologene: 141193
Dnah8
Name: dynein, axonemal, heavy chain 8
Synonyms: Hst6.7b, P1-Loop, Dnahc8
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 13417
VEGA: 17
HGNC: HGNC:2952
Homologene: 1049
Zfp105
Name: zinc finger protein 105
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 22646
Homologene: 2568
Def8
Name: differentially expressed in FDCP 8
Synonyms: D8Ertd713e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 23854
Homologene: 14279
Cert1
Name: ceramide transporter 1
Synonyms: 2810404O15Rik, GPBP, 9230101K08Rik, Cert, ceramide transport protein, Col4a3bp
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 68018
VEGA: 13
HGNC: HGNC:2205
Homologene: 4173
Tatdn1
Name: TatD DNase domain containing 1
Synonyms: 2310079P03Rik, CDA11
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 69694
VEGA: 15
Homologene: 57158
Piezo1
Name: piezo-type mechanosensitive ion channel component 1
Synonyms: Piezo1, Fam38a
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234839
Homologene: 124356
Fam169b
Name: family with sequence similarity 169, member B
Synonyms: EG434197
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 434197
Homologene: 79038
Pcdhb16
Name: protocadherin beta 16
Synonyms: PcdhbP, Pcdhb8
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93887
Homologene: 99843
Snx27
Name: sorting nexin family member 27
Synonyms: 5730552M22Rik, ESTM47
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 76742
Homologene: 12797
Siglec15
Name: sialic acid binding Ig-like lectin 15
Synonyms: EG620235, Cd33l3
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 620235
Homologene: 52643
Olig3
Name: oligodendrocyte transcription factor 3
Synonyms: Bhlhb7, bHLHe20
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 94222
VEGA: 10
Homologene: 14201
Peg10
Name: paternally expressed 10
Synonyms: MEF3L, HB-1, MyEF-3, MyEF-3 like, Edr, Mart2, Mar2, Rtl2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 170676
Homologene: 116067
Ldlrad4
Name: low density lipoprotein receptor class A domain containing 4
Synonyms: D330030L18Rik, A430108L08Rik, 8230401C20Rik, D18Ertd653e
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 52662
VEGA: 18
HGNC: HGNC:1224
Homologene: 3202
Arrdc2
Name: arrestin domain containing 2
Synonyms: 4632416I05Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 70807
Homologene: 79540
Ptpdc1
Name: protein tyrosine phosphatase domain containing 1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218232
VEGA: 13
Homologene: 17576
Or13n4
Name: olfactory receptor family 13 subfamily N member 4
Synonyms: GA_x6K02T2PBJ9-9202245-9201289, MOR260-4, Olfr702
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258590
Homologene: 121512
Ap4b1
Name: adaptor-related protein complex AP-4, beta 1
Synonyms: AP-4 beta-4, 1810038H16Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 67489
HGNC: HGNC:572
Homologene: 38203
Ighv8-5
Name: immunoglobulin heavy variable V8-5
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 640506
Adcy2
Name: adenylate cyclase 2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 210044
VEGA: 13
HGNC: HGNC:233
Homologene: 75133
Ltbp2
Name: latent transforming growth factor beta binding protein 2
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 16997
HGNC: HGNC:6715
Homologene: 369
Or5b120
Name: olfactory receptor family 5 subfamily B member 120
Synonyms: GA_x6K02T2RE5P-3834960-3835907, MOR202-10, Olfr1477
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258691
Homologene: 110492
Abcb1b
Name: ATP-binding cassette, sub-family B member 1B
Synonyms: Mdr1, Mdr1b, mdr, Pgy1, Pgy-1, Abcb1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18669
HGNC: HGNC:40
Homologene: 69084
Ahnak
Name: AHNAK nucleoprotein
Synonyms: DY6, 2310047C17Rik, 1110004P15Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 66395
VEGA: 19
HGNC: HGNC:347
Homologene: 67425
Skint10
Name: selection and upkeep of intraepithelial T cells 10
Synonyms: A030001H23Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230613
Homologene: 136292
Tlr11
Name: toll-like receptor 11
Synonyms: LOC239081
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 239081
Homologene: 77905
Aadacl2fm2
Name: AADACL2 family member 2
Synonyms: Gm5538
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 433597
Homologene: 79018
Atp9a
Name: ATPase, class II, type 9A
Synonyms: Class II, IIa
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11981
Homologene: 69194
Tas2r143
Name: taste receptor, type 2, member 143
Synonyms: Tas2r43, mt2r36
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 387514
Homologene: 74285
Ces1d
Name: carboxylesterase 1D
Synonyms: TGH, Ces3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 104158
HGNC: HGNC:1863
Homologene: 35606
Pus1
Name: pseudouridine synthase 1
Synonyms: MPUS1, mPus1p, A730013B20Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 56361
Homologene: 5931
Ccdc42
Name: coiled-coil domain containing 42
Synonyms: A530001H01Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 276920
Homologene: 44902
Zfp426
Name: zinc finger protein 426
Synonyms: KRAB1, 2900057C04Rik, Zfo61, Zfp68-rs1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235028
Homologene: 23435
Slc5a1
Name: solute carrier family 5 (sodium/glucose cotransporter), member 1
Synonyms: sodium glucose cotransporter 1, Sglt1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20537
Homologene: 55456
Zfp536
Name: zinc finger protein 536
Synonyms: 9630010P11Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243937
Homologene: 8813
Pou6f2
Name: POU domain, class 6, transcription factor 2
Synonyms: RPF-1, D130006K24Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218030
Ttll3
Name: tubulin tyrosine ligase-like family, member 3
Synonyms: 4833441J24Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 101100
Homologene: 134361
Alpk1
Name: alpha-kinase 1
Synonyms: 8430410J10Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 71481
Homologene: 11849
Or14j7
Name: olfactory receptor family 14 subfamily J member 7
Synonyms: GA_x6K02T2PSCP-2374126-2375048, MOR218-13, Olfr128
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 383243
Homologene: 134080
Rnf144a
Name: ring finger protein 144A
Synonyms: UIP4, Rnf144
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 108089
VEGA: 12
Homologene: 40982
Mapk8ip2
Name: mitogen-activated protein kinase 8 interacting protein 2
Synonyms: JNK-interacting protein, Jip2, 3230402N03Rik, IB2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 60597
HGNC: HGNC:6883
Homologene: 8201
Nek5
Name: NIMA (never in mitosis gene a)-related expressed kinase 5
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 330721
HGNC: HGNC:7748
Homologene: 87952
Krt39
Name: keratin 39
Synonyms: 4732494G06Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237934
Homologene: 19078
Fbxo40
Name: F-box protein 40
Synonyms: 9830003A13Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 207215
Homologene: 9459
Plod3
Name: procollagen-lysine, 2-oxoglutarate 5-dioxygenase 3
Synonyms: lysyl hydroxylase 3, LH3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 26433
HGNC: HGNC:9083
Homologene: 843
Mknk2
Name: MAP kinase-interacting serine/threonine kinase 2
Synonyms: Mnk2, 2010016G11Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 17347
HGNC: HGNC:7111
Homologene: 49674
Mllt11
Name: myeloid/lymphoid or mixed-lineage leukemia; translocated to, 11
Synonyms: Af1q
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 56772
Homologene: 4964
Ppl
Name: periplakin
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 19041
VEGA: 16
HGNC: HGNC:9273
Homologene: 2026
Hdhd3
Name: haloacid dehalogenase-like hydrolase domain containing 3
Synonyms: 2810435D12Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 72748
Homologene: 11497
Dcpp2
Name: demilune cell and parotid protein 2
Synonyms: EG630537
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 630537
VEGA: 17
Homologene: 103921
Evi2a
Name: ecotropic viral integration site 2a
Synonyms: Evi-2, Evi2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14017
HGNC: HGNC:3499
Homologene: 49234
Or6aa1
Name: olfactory receptor family 6 subfamily AA member 1
Synonyms: GA_x6K02T2NHDJ-9712819-9713778, MOR104-2, Olfr303
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258612
Homologene: 105157
Gsg1l2
Name: GSG1-like 2
Synonyms: Gm12302
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 544792
Homologene: 132038
Mad2l1bp
Name: MAD2L1 binding protein
Synonyms: 0610009D16Rik, CMT2B, CMT2A, 2510031P20Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 66591
VEGA: 17
Homologene: 11990
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 59,913,678 bp
  • G to A, chromosome 1 at 71,414,678 bp
  • G to A, chromosome 2 at 26,390,132 bp
  • C to A, chromosome 2 at 129,125,544 bp
  • A to G, chromosome 2 at 168,705,194 bp
  • A to G, chromosome 3 at 59,743,691 bp
  • T to C, chromosome 3 at 90,424,012 bp
  • A to G, chromosome 3 at 94,519,059 bp
  • A to G, chromosome 3 at 95,220,237 bp
  • T to A, chromosome 3 at 96,920,319 bp
  • T to G, chromosome 3 at 103,815,082 bp
  • A to T, chromosome 3 at 127,680,051 bp
  • C to A, chromosome 4 at 62,499,995 bp
  • G to A, chromosome 4 at 112,774,806 bp
  • C to A, chromosome 4 at 147,058,090 bp
  • T to C, chromosome 5 at 8,837,747 bp
  • G to A, chromosome 5 at 28,166,596 bp
  • T to C, chromosome 5 at 33,146,713 bp
  • A to G, chromosome 5 at 110,779,716 bp
  • C to T, chromosome 5 at 135,911,540 bp
  • A to G, chromosome 5 at 136,989,981 bp
  • GC to GCTCC, chromosome 6 at 4,756,452 bp
  • A to T, chromosome 6 at 29,923,929 bp
  • A to G, chromosome 6 at 42,400,722 bp
  • CAAAGTAA to CAAAGTAAAGTAA, chromosome 6 at 113,399,157 bp
  • TAA to TAAAGCAA, chromosome 6 at 113,399,162 bp
  • T to C, chromosome 7 at 5,074,662 bp
  • T to A, chromosome 7 at 37,569,688 bp
  • A to G, chromosome 7 at 68,304,590 bp
  • T to A, chromosome 7 at 86,394,557 bp
  • G to A, chromosome 7 at 102,124,362 bp
  • A to G, chromosome 7 at 106,823,725 bp
  • C to A, chromosome 8 at 22,083,387 bp
  • T to C, chromosome 8 at 66,704,212 bp
  • A to T, chromosome 8 at 70,839,394 bp
  • A to G, chromosome 8 at 93,197,666 bp
  • G to A, chromosome 8 at 122,482,920 bp
  • C to A, chromosome 8 at 123,447,321 bp
  • G to T, chromosome 9 at 18,595,223 bp
  • A to T, chromosome 9 at 20,470,150 bp
  • T to C, chromosome 9 at 82,908,833 bp
  • T to A, chromosome 9 at 110,960,981 bp
  • A to G, chromosome 9 at 122,930,743 bp
  • A to T, chromosome 10 at 19,356,770 bp
  • A to C, chromosome 10 at 80,667,187 bp
  • T to A, chromosome 11 at 67,785,271 bp
  • G to A, chromosome 11 at 68,594,196 bp
  • T to C, chromosome 11 at 79,527,862 bp
  • T to C, chromosome 11 at 99,519,075 bp
  • A to G, chromosome 11 at 107,047,187 bp
  • T to C, chromosome 12 at 26,339,440 bp
  • T to A, chromosome 12 at 84,789,881 bp
  • C to A, chromosome 12 at 87,200,217 bp
  • T to C, chromosome 12 at 115,067,638 bp
  • C to A, chromosome 13 at 18,378,507 bp
  • A to T, chromosome 13 at 24,036,438 bp
  • A to G, chromosome 13 at 48,579,788 bp
  • A to T, chromosome 13 at 68,689,281 bp
  • A to G, chromosome 13 at 96,617,055 bp
  • A to G, chromosome 13 at 111,756,129 bp
  • A to G, chromosome 14 at 50,361,154 bp
  • T to C, chromosome 15 at 58,904,758 bp
  • T to G, chromosome 15 at 89,458,119 bp
  • T to C, chromosome 15 at 94,325,933 bp
  • T to A, chromosome 16 at 5,087,964 bp
  • T to A, chromosome 16 at 36,969,499 bp
  • C to T, chromosome 16 at 90,481,326 bp
  • T to G, chromosome 17 at 23,900,592 bp
  • CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT to CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT, chromosome 17 at 30,760,867 bp
  • T to A, chromosome 17 at 37,923,677 bp
  • A to T, chromosome 17 at 46,148,067 bp
  • A to G, chromosome 17 at 50,782,263 bp
  • A to G, chromosome 18 at 37,478,851 bp
  • A to G, chromosome 18 at 68,254,424 bp
  • A to T, chromosome 18 at 78,057,230 bp
  • A to T, chromosome 19 at 9,005,344 bp
  • T to G, chromosome 19 at 13,503,223 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7827 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045881-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.