Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7827Btlr/Mmmh
Stock Number:
045881-MU
Citation ID:
RRID:MMRRC_045881-MU
Other Names:
R7827 (G1)
Major Collection:

Strain Information

Adamts20
Name: ADAM metallopeptidase with thrombospondin type 1 motif 20
Synonyms: ADAMTS-20, bt
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223838
Homologene: 11808
Fam117b
Name: family with sequence similarity 117, member B
Synonyms: 6330416D14Rik, 2810425F24Rik, Als2cr13
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 72750
Homologene: 18307
Npy1r
Name: neuropeptide Y receptor Y1
Synonyms: Y1-R, Npyr
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 18166
HGNC: HGNC:7956
Homologene: 700
Abca12
Name: ATP-binding cassette, sub-family A member 12
Synonyms: 4832428G11Rik, 4833417A11Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74591
Homologene: 45441
U2af2
Name: U2 small nuclear ribonucleoprotein auxiliary factor (U2AF) 2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22185
Homologene: 110853
Pmpca
Name: peptidase (mitochondrial processing) alpha
Synonyms: INPP5E, Alpha-MPP, 4933435E07Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66865
Homologene: 6078
Lrrc2
Name: leucine rich repeat containing 2
Synonyms: 2400002D05Rik, 4933431K03Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74249
Homologene: 23454
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 59,913,678 bp
  • G to A, chromosome 1 at 71,414,678 bp
  • G to A, chromosome 2 at 26,390,132 bp
  • C to A, chromosome 2 at 129,125,544 bp
  • A to G, chromosome 2 at 168,705,194 bp
  • A to G, chromosome 3 at 59,743,691 bp
  • T to C, chromosome 3 at 90,424,012 bp
  • A to G, chromosome 3 at 94,519,059 bp
  • A to G, chromosome 3 at 95,220,237 bp
  • T to A, chromosome 3 at 96,920,319 bp
  • T to G, chromosome 3 at 103,815,082 bp
  • A to T, chromosome 3 at 127,680,051 bp
  • C to A, chromosome 4 at 62,499,995 bp
  • G to A, chromosome 4 at 112,774,806 bp
  • C to A, chromosome 4 at 147,058,090 bp
  • T to C, chromosome 5 at 8,837,747 bp
  • G to A, chromosome 5 at 28,166,596 bp
  • T to C, chromosome 5 at 33,146,713 bp
  • A to G, chromosome 5 at 110,779,716 bp
  • C to T, chromosome 5 at 135,911,540 bp
  • A to G, chromosome 5 at 136,989,981 bp
  • GC to GCTCC, chromosome 6 at 4,756,452 bp
  • A to T, chromosome 6 at 29,923,929 bp
  • A to G, chromosome 6 at 42,400,722 bp
  • CAAAGTAA to CAAAGTAAAGTAA, chromosome 6 at 113,399,157 bp
  • TAA to TAAAGCAA, chromosome 6 at 113,399,162 bp
  • T to C, chromosome 7 at 5,074,662 bp
  • T to A, chromosome 7 at 37,569,688 bp
  • A to G, chromosome 7 at 68,304,590 bp
  • T to A, chromosome 7 at 86,394,557 bp
  • G to A, chromosome 7 at 102,124,362 bp
  • A to G, chromosome 7 at 106,823,725 bp
  • C to A, chromosome 8 at 22,083,387 bp
  • T to C, chromosome 8 at 66,704,212 bp
  • A to T, chromosome 8 at 70,839,394 bp
  • A to G, chromosome 8 at 93,197,666 bp
  • G to A, chromosome 8 at 122,482,920 bp
  • C to A, chromosome 8 at 123,447,321 bp
  • G to T, chromosome 9 at 18,595,223 bp
  • A to T, chromosome 9 at 20,470,150 bp
  • T to C, chromosome 9 at 82,908,833 bp
  • T to A, chromosome 9 at 110,960,981 bp
  • A to G, chromosome 9 at 122,930,743 bp
  • A to T, chromosome 10 at 19,356,770 bp
  • A to C, chromosome 10 at 80,667,187 bp
  • T to A, chromosome 11 at 67,785,271 bp
  • G to A, chromosome 11 at 68,594,196 bp
  • T to C, chromosome 11 at 79,527,862 bp
  • T to C, chromosome 11 at 99,519,075 bp
  • A to G, chromosome 11 at 107,047,187 bp
  • T to C, chromosome 12 at 26,339,440 bp
  • T to A, chromosome 12 at 84,789,881 bp
  • C to A, chromosome 12 at 87,200,217 bp
  • T to C, chromosome 12 at 115,067,638 bp
  • C to A, chromosome 13 at 18,378,507 bp
  • A to T, chromosome 13 at 24,036,438 bp
  • A to G, chromosome 13 at 48,579,788 bp
  • A to T, chromosome 13 at 68,689,281 bp
  • A to G, chromosome 13 at 96,617,055 bp
  • A to G, chromosome 13 at 111,756,129 bp
  • A to G, chromosome 14 at 50,361,154 bp
  • T to C, chromosome 15 at 58,904,758 bp
  • T to G, chromosome 15 at 89,458,119 bp
  • T to C, chromosome 15 at 94,325,933 bp
  • T to A, chromosome 16 at 5,087,964 bp
  • T to A, chromosome 16 at 36,969,499 bp
  • C to T, chromosome 16 at 90,481,326 bp
  • T to G, chromosome 17 at 23,900,592 bp
  • CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT to CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT, chromosome 17 at 30,760,867 bp
  • T to A, chromosome 17 at 37,923,677 bp
  • A to T, chromosome 17 at 46,148,067 bp
  • A to G, chromosome 17 at 50,782,263 bp
  • A to G, chromosome 18 at 37,478,851 bp
  • A to G, chromosome 18 at 68,254,424 bp
  • A to T, chromosome 18 at 78,057,230 bp
  • A to T, chromosome 19 at 9,005,344 bp
  • T to G, chromosome 19 at 13,503,223 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7827 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045881-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.