Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7829Btlr/Mmmh
Stock Number:
045883-MU
Citation ID:
RRID:MMRRC_045883-MU
Other Names:
R7829 (G1)
Major Collection:

Strain Information

Abca12
Name: ATP-binding cassette, sub-family A member 12
Synonyms: 4832428G11Rik, 4833417A11Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74591
Homologene: 45441
Suclg1
Name: succinate-CoA ligase, GDP-forming, alpha subunit
Synonyms: Sucla1, 1500000I01Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 56451
Homologene: 55785
Rbm6
Name: RNA binding motif protein 6
Synonyms: NY-LU-12, g16, Def-3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 19654
HGNC: HGNC:9903
Homologene: 31336
Rev1
Name: REV1, DNA directed polymerase
Synonyms: REV1, 1110027I23Rik, Rev1l
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 56210
Homologene: 32309
Kif1b
Name: kinesin family member 1B
Synonyms: D4Mil1e, Kif1b alpha, Kif1b beta, KIF1Bp130, KIF1Bp204, N-3 kinesin, A530096N05Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 16561
Homologene: 99835
Zfp106
Name: zinc finger protein 106
Synonyms: Cd-1, H3a, sirm, Sh3bp3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20402
Homologene: 40787
Rpap3
Name: RNA polymerase II associated protein 3
Synonyms: 2310042P20Rik, D15Ertd682e
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 71919
VEGA: 15
Homologene: 11613
Gtpbp4
Name: GTP binding protein 4
Synonyms: 2610028C09Rik, Crfg, Nog1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 69237
VEGA: 13
Homologene: 7100
Mphosph6
Name: M phase phosphoprotein 6
Synonyms: C86426, 1110001M01Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 68533
HGNC: HGNC:7214
Homologene: 38100
Anapc2
Name: anaphase promoting complex subunit 2
Synonyms: expressed during mesenchymal induction 4, Emi4, APC2, 9230107K09Rik, Imi4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 99152
Homologene: 8359
Dmbx1
Name: diencephalon/mesencephalon homeobox 1
Synonyms: Cdmx, Atx, Mbx, Dmbx1, Otx3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 140477
Homologene: 15639
Ubqln1
Name: ubiquilin 1
Synonyms: XDRP1, Dsk2, DA41, Plic-1, 1110046H03Rik, 1810030E05Rik, D13Ertd372e
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 56085
VEGA: 13
Homologene: 137258
Syne1
Name: spectrin repeat containing, nuclear envelope 1
Synonyms: nesprin-1, SYNE-1, enaptin165, A330049M09Rik, C130039F11Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 64009
VEGA: 10
Homologene: 52329
Ryr2
Name: ryanodine receptor 2, cardiac
Synonyms: 9330127I20Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20191
VEGA: 13
Homologene: 37423
Zkscan5
Name: zinc finger with KRAB and SCAN domains 5
Synonyms: hKraba1, Zfp95
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22757
Homologene: 8734
Trappc10
Name: trafficking protein particle complex 10
Synonyms: LOC380642, B230307C21Rik, Tmem1, b2b2613Clo, b2b2416Clo
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216131
VEGA: 10
Homologene: 37751
Insig2
Name: insulin induced gene 2
Synonyms: Insig-2, 2900053I11Rik, C730043J18Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 72999
Homologene: 9400
Arhgef17
Name: Rho guanine nucleotide exchange factor 17
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 207212
Homologene: 129601
2810021J22Rik
Name: RIKEN cDNA 2810021J22 gene
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 69944
Homologene: 138400
Hsd17b14
Name: hydroxysteroid (17-beta) dehydrogenase 14
Synonyms: retSDR3, 0610039E24Rik, Dhrs10
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 66065
Homologene: 133800
Grhl3
Name: grainyhead like transcription factor 3
Synonyms: Som, Get1, ct
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230824
Homologene: 18864
Copb2
Name: COPI coat complex subunit beta 2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 50797
HGNC: HGNC:2232
Homologene: 3499
Crnkl1
Name: crooked neck pre-mRNA splicing factor 1
Synonyms: crn, 1200013P10Rik, 5730590A01Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66877
Homologene: 6462
Dtwd1
Name: DTW domain containing 1
Synonyms: 1810033A06Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 69185
Homologene: 10633
Nbeal1
Name: neurobeachin like 1
Synonyms: A530050O19Rik, ALS2CR17, A530083I02Rik, 2310076G13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 269198
Homologene: 16453
Slc11a2
Name: solute carrier family 11 (proton-coupled divalent metal ion transporters), member 2
Synonyms: DMT1, DCT1, van, Nramp2, microcytic anemia, viable anaemia
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 18174
Homologene: 55471
Itgae
Name: integrin alpha E, epithelial-associated
Synonyms: CD103, alpha-E1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16407
HGNC: HGNC:6147
Homologene: 113560
Cfap74
Name: cilia and flagella associated protein 74
Synonyms: 2010015L04Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 544678
Homologene: 129584
Creb3
Name: cAMP responsive element binding protein 3
Synonyms: LZIP-2, LZIP-1, Luman, LZIP
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12913
HGNC: HGNC:2347
Homologene: 31375
Piezo2
Name: piezo-type mechanosensitive ion channel component 2
Synonyms: 9430028L06Rik, 9030411M15Rik, Fam38b2, Piezo2, Fam38b
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 667742
Homologene: 49695
Dnah6
Name: dynein, axonemal, heavy chain 6
Synonyms: A730004I20Rik, Dnahc6
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330355
HGNC: HGNC:2951
Homologene: 15221
Loxhd1
Name: lipoxygenase homology domains 1
Synonyms: 1700096C21Rik, sba
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240411
Lrp1b
Name: low density lipoprotein-related protein 1B
Synonyms: 9630004P12Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 94217
HGNC: HGNC:6693
Homologene: 56810
Dll3
Name: delta like canonical Notch ligand 3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13389
HGNC: HGNC:2909
Homologene: 7291
Mug5
Name: murinoglobulin 5
Synonyms: Gm7298
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 640530
HGNC: HGNC:9750
Csrp2
Name: cysteine and glycine-rich protein 2
Synonyms: SmLim, Crp2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 13008
VEGA: 10
HGNC: HGNC:2470
Homologene: 111061
Nlrc5
Name: NLR family, CARD domain containing 5
Synonyms: AI451557
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 434341
Homologene: 88935
Adamts3
Name: ADAM metallopeptidase with thrombospondin type 1 motif 3
Synonyms: 6330442E02Rik, 1100001H14Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 330119
HGNC: HGNC:219
Homologene: 8596
Naglu
Name: alpha-N-acetylglucosaminidase (Sanfilippo disease IIIB)
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 27419
HGNC: HGNC:7632
Homologene: 222
Osbpl6
Name: oxysterol binding protein-like 6
Synonyms: ORP-6, 1110062M20Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 99031
Homologene: 101447
Tmprss15
Name: transmembrane protease, serine 15
Synonyms: enteropeptidase, enterokinase, A130097D21Rik, Prss7
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 19146
HGNC: HGNC:9490
Homologene: 2075
Adam10
Name: a disintegrin and metallopeptidase domain 10
Synonyms: kuz, kuzbanian, 1700031C13Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 11487
HGNC: HGNC:188
Homologene: 865
Samd9l
Name: sterile alpha motif domain containing 9-like
Synonyms: ESTM25
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 209086
HGNC: HGNC:1349
Homologene: 7707
Sipa1l2
Name: signal-induced proliferation-associated 1 like 2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244668
Homologene: 18956
Armc2
Name: armadillo repeat containing 2
Synonyms: 2610018I05Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 213402
Homologene: 41848
Pdzd7
Name: PDZ domain containing 7
Synonyms: Pdzk7, EG435601
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 100503041
Homologene: 129509
Adcy7
Name: adenylate cyclase 7
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 11513
HGNC: HGNC:238
Homologene: 866
Pla2g5
Name: phospholipase A2, group V
Synonyms: sPLA2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18784
HGNC: HGNC:9038
Homologene: 716
Sry
Name: sex determining region of Chr Y
Synonyms: Tdf, Tdy
Type: Gene
Species: Mouse
Chromosome: Y
NCBI: 21674
Pigc
Name: phosphatidylinositol glycan anchor biosynthesis, class C
Synonyms: 3110030E07Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 67292
HGNC: HGNC:8960
Homologene: 7109
Fhod3
Name: formin homology 2 domain containing 3
Synonyms: A930009H06Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225288
VEGA: 18
Homologene: 45323
Gm10549
Name: predicted gene 10549
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 433171
VEGA: 18
Abcb1a
Name: ATP-binding cassette, sub-family B member 1A
Synonyms: mdr-3, Mdr1a, P-gp, P-glycoprotein, Pgy-3, Pgy3, multiple drug resistant 1a, MDR3, Pgp, Evi32
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18671
HGNC: HGNC:40
Homologene: 55496
Lrrc23
Name: leucine rich repeat containing 23
Synonyms: 4921537K05Rik, Lrpb7
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16977
Homologene: 5082
Oscp1
Name: organic solute carrier partner 1
Synonyms: 6030436A01Rik, 1810007P19Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230751
Homologene: 71010
Kmo
Name: kynurenine 3-monooxygenase
Synonyms: kynurenine 3-hydroxylase
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98256
HGNC: HGNC:6381
Homologene: 2729
Or1o2
Name: olfactory receptor family 1 subfamily O member 2
Synonyms: MOR156-2, GA_x6K02T2PSCP-1672287-1671355, Olfr97
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 258505
Homologene: 133051
Or6k2
Name: olfactory receptor family 6 subfamily K member 2
Synonyms: GA_x6K02T2P20D-20995211-20994246, MOR105-10, Olfr420
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 258302
Homologene: 17185
Or10al7
Name: olfactory receptor family 10 subfamily AL member 7
Synonyms: MOR263-9, GA_x6K02T2PSCP-2503741-2502776, Olfr129
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 258324
Homologene: 133641
Tox2
Name: TOX high mobility group box family member 2
Synonyms: RxHMG1, LOC269389
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 269389
Homologene: 13155
Alg9
Name: ALG9 alpha-1,2-mannosyltransferase
Synonyms: 8230402H15Rik, B430313H07Rik, Dibd1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 102580
Homologene: 6756
Myl10
Name: myosin, light chain 10, regulatory
Synonyms: PLRLC-C, PLRLC-B, PLRLC-A, PLRLC, 1700027I08Rik, Mylc2pl
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 59310
Homologene: 69341
Slfn14
Name: schlafen 14
Synonyms: LOC237890, Slfn14-ps
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237890
Homologene: 19082
Ctsd
Name: cathepsin D
Synonyms: CatD, CD
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13033
HGNC: HGNC:2529
Homologene: 55616
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 38,056,445 bp
  • G to C, chromosome 1 at 60,237,151 bp
  • A to T, chromosome 1 at 71,292,421 bp
  • A to T, chromosome 1 at 121,307,329 bp
  • G to A, chromosome 1 at 161,970,464 bp
  • A to T, chromosome 1 at 174,158,859 bp
  • A to G, chromosome 1 at 175,650,659 bp
  • G to T, chromosome 2 at 25,277,741 bp
  • A to T, chromosome 2 at 40,903,448 bp
  • G to A, chromosome 2 at 76,593,387 bp
  • A to G, chromosome 2 at 120,524,057 bp
  • A to G, chromosome 2 at 126,164,759 bp
  • T to A, chromosome 2 at 145,931,349 bp
  • T to C, chromosome 2 at 163,320,376 bp
  • T to C, chromosome 4 at 43,566,322 bp
  • C to T, chromosome 4 at 115,923,907 bp
  • C to A, chromosome 4 at 126,088,408 bp
  • T to C, chromosome 4 at 135,561,221 bp
  • C to A, chromosome 4 at 138,804,534 bp
  • A to T, chromosome 4 at 149,220,990 bp
  • T to C, chromosome 4 at 155,429,237 bp
  • T to A, chromosome 5 at 8,698,623 bp
  • C to T, chromosome 5 at 89,861,490 bp
  • G to C, chromosome 5 at 136,697,971 bp
  • A to T, chromosome 5 at 145,218,703 bp
  • A to C, chromosome 6 at 3,374,749 bp
  • C to A, chromosome 6 at 73,127,919 bp
  • A to G, chromosome 6 at 73,275,243 bp
  • T to C, chromosome 6 at 121,765,338 bp
  • T to C, chromosome 6 at 124,304,779 bp
  • T to A, chromosome 6 at 124,770,748 bp
  • G to A, chromosome 7 at 28,294,650 bp
  • A to C, chromosome 7 at 45,566,785 bp
  • A to T, chromosome 7 at 100,876,845 bp
  • A to G, chromosome 7 at 142,377,142 bp
  • T to C, chromosome 8 at 88,315,759 bp
  • T to C, chromosome 8 at 94,521,769 bp
  • T to C, chromosome 8 at 117,799,068 bp
  • T to C, chromosome 8 at 125,451,988 bp
  • T to A, chromosome 9 at 50,788,171 bp
  • A to T, chromosome 9 at 70,766,927 bp
  • T to C, chromosome 9 at 98,588,094 bp
  • T to C, chromosome 9 at 107,852,706 bp
  • A to C, chromosome 10 at 5,342,293 bp
  • G to A, chromosome 10 at 41,926,860 bp
  • T to C, chromosome 10 at 78,199,075 bp
  • C to T, chromosome 10 at 110,935,184 bp
  • C to G, chromosome 11 at 58,879,997 bp
  • T to A, chromosome 11 at 73,138,792 bp
  • A to G, chromosome 11 at 83,281,817 bp
  • G to A, chromosome 11 at 101,076,610 bp
  • A to T, chromosome 13 at 8,985,330 bp
  • T to A, chromosome 13 at 11,827,607 bp
  • C to T, chromosome 13 at 58,177,905 bp
  • A to T, chromosome 15 at 97,681,708 bp
  • G to A, chromosome 15 at 100,409,261 bp
  • T to C, chromosome 16 at 78,987,650 bp
  • T to C, chromosome 17 at 37,232,310 bp
  • T to C, chromosome 17 at 38,055,329 bp
  • G to A, chromosome 18 at 25,115,890 bp
  • C to A, chromosome 18 at 33,464,410 bp
  • A to T, chromosome 18 at 63,113,876 bp
  • A to G, chromosome 18 at 77,408,787 bp
  • C to A, chromosome 19 at 45,039,239 bp
  • GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG to GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG, chromosome Y at 2,662,638 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7829 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045883-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.