Strain Name:
C57BL/6J-MtgxR7851Btlr/Mmmh
Stock Number:
045904-MU
Citation ID:
RRID:MMRRC_045904-MU
Other Names:
R7851 (G1)
Major Collection:

Strain Information

Cd2ap
Name: CD2-associated protein
Synonyms: METS-1, Mets1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12488
VEGA: 17
Homologene: 7663
Hsp90ab1
Name: heat shock protein 90 alpha (cytosolic), class B member 1
Synonyms: Hspcb, Hsp90, C81438, Hsp84, Hsp84-1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 15516
Homologene: 74306
Arhgef18
Name: Rho/Rac guanine nucleotide exchange factor 18
Synonyms: D030053O22Rik, A430078G23Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 102098
Homologene: 32254
Cnot2
Name: CCR4-NOT transcription complex, subunit 2
Synonyms: 2810470K03Rik, 2600016M12Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 72068
HGNC: HGNC:7878
Homologene: 40953
Etl4
Name: enhancer trap locus 4
Synonyms: Etl-4, Skt, E330027G05Rik, 9430077C05Rik, Sickle tail, 6620402G01Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 208618
Homologene: 10477
Wdr7
Name: WD repeat domain 7
Synonyms: TRAG, TGF-beta resistance associated gene
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 104082
VEGA: 18
Homologene: 11408
Snx8
Name: sorting nexin 8
Synonyms: B130023O14Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231834
Homologene: 8338
Cnn3
Name: calponin 3, acidic
Synonyms: Calpo3, 1600014M03Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 71994
HGNC: HGNC:2157
Homologene: 37533
Ptcd3
Name: pentatricopeptide repeat domain 3
Synonyms: 2610034F17Rik, 2810422B04Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 69956
Homologene: 41211
Csf2rb2
Name: colony stimulating factor 2 receptor, beta 2, low-affinity (granulocyte-macrophage)
Synonyms: Il3rb2, BetaIl3, Bil3, Il3r, AIC2A
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12984
VEGA: 15
HGNC: HGNC:2436
Homologene: 339
Scn10a
Name: sodium channel, voltage-gated, type X, alpha
Synonyms: Nav1.8
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20264
VEGA: 9
Homologene: 21300
Aarsd1
Name: alanyl-tRNA synthetase domain containing 1
Synonyms: 2310044P18Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 69684
Homologene: 6821
Gfral
Name: GDNF family receptor alpha like
Synonyms: GRAL
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 404194
Homologene: 45748
Pamr1
Name: peptidase domain containing associated with muscle regeneration 1
Synonyms: RAMP, E430002G05Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 210622
Homologene: 9134
Ptprs
Name: protein tyrosine phosphatase receptor type S
Synonyms: PTP-NU3, RPTPsigma, Ptpt9, PTPsigma
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 19280
HGNC: HGNC:9681
Homologene: 20626
Sec61a1
Name: SEC61 translocon subunit alpha 1
Synonyms: Sec61a
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 53421
Homologene: 55537
Smurf2
Name: SMAD specific E3 ubiquitin protein ligase 2
Synonyms: 2810411E22Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 66313
Homologene: 41490
Tmco1
Name: transmembrane and coiled-coil domains 1
Synonyms: ESTM39, 4930403O06Rik, 1190006A08Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 68944
Homologene: 10384
Baz2b
Name: bromodomain adjacent to zinc finger domain, 2B
Synonyms: D2Ertd794e, 5830435C13Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 407823
HGNC: HGNC:963
Homologene: 8394
Asxl3
Name: ASXL transcriptional regulator 3
Synonyms: D930044O18Rik, D430002O22Rik, C230079D11Rik, LOC381127
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 211961
Homologene: 19371
St6galnac2
Name: ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 2
Synonyms: Siat7b, Siat7, ST6GalNAc II
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20446
Homologene: 4714
Prickle1
Name: prickle planar cell polarity protein 1
Synonyms: Pk1, b2b019Clo, 1110058P22Rik, mpk1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 106042
Homologene: 17686
Pced1a
Name: PC-esterase domain containing 1A
Synonyms: Fam113a, A930025D01Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 319513
Homologene: 11241
Myh6
Name: myosin, heavy polypeptide 6, cardiac muscle, alpha
Synonyms: A830009F23Rik, alphaMHC, Myhca, alpha myosin, Myhc-a, alpha-MHC, alpha cardiac MHC, cardiomyopathy, hypertrophic 1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 17888
HGNC: HGNC:7576
Homologene: 124414
Dok7
Name: docking protein 7
Synonyms: Dok-7, EF-12, A930013K19Rik, Oit5
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231134
Homologene: 18210
Neb
Name: nebulin
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17996
HGNC: HGNC:7720
Homologene: 136285
Sybu
Name: syntabulin (syntaxin-interacting)
Synonyms: Golsyn/Syntabulin, 5730410E15Rik, A830027B17Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 319613
VEGA: 15
Homologene: 9838
Eogt
Name: EGF domain specific O-linked N-acetylglucosamine transferase
Synonyms: A130022J15Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 101351
Homologene: 65276
Ryr3
Name: ryanodine receptor 3
Synonyms: calcium release channel isoform 3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20192
Homologene: 68151
Odad4
Name: outer dynein arm complex subunit 4
Synonyms: 4933404O19Rik, Ttc25
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74407
Homologene: 12860
Adamts9
Name: ADAM metallopeptidase with thrombospondin type 1 motif 9
Synonyms: Mhdaund3, Mhdaund4, 1810011L16Rik, UND4, E030027K14Rik, 8430403M15Rik, Gsfund3, UND3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 101401
Homologene: 18821
Tshz3
Name: teashirt zinc finger family member 3
Synonyms: A630038G13Rik, Tsh3, Zfp537, teashirt3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243931
Homologene: 10835
Pigs
Name: phosphatidylinositol glycan anchor biosynthesis, class S
Synonyms: LOC276846, LOC245087
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 276846
Homologene: 41963
Arfgef3
Name: ARFGEF family member 3
Synonyms: B930094H20Rik, BIG3, D10Bwg1379e
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 215821
VEGA: 10
Homologene: 41366
Sgsm3
Name: small G protein signaling modulator 3
Synonyms: 1810012I01Rik, Rutbc3, CIP85
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 105835
Homologene: 9249
Sp100
Name: nuclear antigen Sp100
Synonyms: A430075G10Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 20684
Homologene: 86761
Tcf21
Name: transcription factor 21
Synonyms: Pod1, epc, epicardin, bHLHa23, podocyte-expressed 1, Pod-1, capsulin
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 21412
VEGA: 10
Homologene: 2414
Spire2
Name: spire type actin nucleation factor 2
Synonyms: Spir-2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234857
Homologene: 72212
Vmn2r62
Name: vomeronasal 2, receptor 62
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 546964
Homologene: 104832
Or2w25
Name: olfactory receptor family 2 subfamily W member 25
Synonyms: Olfr225, MOR256-51, GA_x6K02T0073K-490-1545
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 257886
Homologene: 105324
Abcc3
Name: ATP-binding cassette, sub-family C member 3
Synonyms: 1700019L09Rik, MRP3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76408
HGNC: HGNC:54
Homologene: 68364
Ism1
Name: isthmin 1, angiogenesis inhibitor
Synonyms: 5430433G21Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 319909
Homologene: 19061
Atp6v0b
Name: ATPase, H+ transporting, lysosomal V0 subunit B
Synonyms: 2310024H13Rik, VMA16, Atp6f
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 114143
HGNC: HGNC:861
Homologene: 2986
Rft1
Name: RFT1 homolog
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 328370
Homologene: 5343
Or1j4
Name: olfactory receptor family 1 subfamily J member 4
Synonyms: GA_x6K02T2NLDC-33544602-33545540, MOR136-13, Olfr350
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258620
HGNC: HGNC:8211
Homologene: 64897
Ankmy1
Name: ankyrin repeat and MYND domain containing 1
Synonyms: 4930483I10Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241158
Homologene: 9561
Tlr1
Name: toll-like receptor 1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 21897
Homologene: 20694
Rcn3
Name: reticulocalbin 3, EF-hand calcium binding domain
Synonyms: D7Ertd671e, RLP49, D530026G20Rik, 6030455P07Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 52377
Homologene: 10775
Plch1
Name: phospholipase C, eta 1
Synonyms: PLCeta1, Plcl3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 269437
Homologene: 88833
Or11h4b
Name: olfactory receptor family 11 subfamily H member 4B
Synonyms: MOR106-16, MOR106-7, Olfr747, GA_x6K02T2PMLR-6420220-6419279
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 258264
Homologene: 10652
Or6c5c
Name: olfactory receptor family 6 subfamily C member 5C
Synonyms: GA_x6K02T2PULF-11141498-11142436, MOR111-10, Olfr787
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 258069
Homologene: 105326
Mup3
Name: major urinary protein 3
Synonyms: Mup-3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 17842
Homologene: 74304
Or11g24
Name: olfactory receptor family 11 subfamily G member 24
Synonyms: Olfr739, GA_x6K02T2PMLR-6121675-6122604, MOR106-2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 258663
Homologene: 121549
Hyal6
Name: hyaluronoglucosaminidase 6
Synonyms: 4932701A20Rik, Hyal-ps1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 74409
HGNC: HGNC:5324
Homologene: 78028
Coq6
Name: coenzyme Q6 monooxygenase
Synonyms: 5930427M12Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217707
Homologene: 6039
Ipp
Name: IAP promoted placental gene
Synonyms: D4Jhu8, Mipp
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 16351
HGNC: HGNC:6108
Homologene: 4309
Terb2
Name: telomere repeat binding bouquet formation protein 2
Synonyms: 4933406J08Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74401
Homologene: 17583
Calcoco2
Name: calcium binding and coiled-coil domain 2
Synonyms: Ndp52, 2410154J16Rik, Ndp52l1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76815
Gsdmc4
Name: gasdermin C4
Synonyms: 9030605I04Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 74548
HGNC: HGNC:7151
Homologene: 69487
Jrkl
Name: Jrk-like
Synonyms: C030035D04Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 77532
VEGA: 9
HGNC: HGNC:6200
Homologene: 2797
Gyg1
Name: glycogenin 1
Synonyms: Gyg
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 27357
HGNC: HGNC:4699
Homologene: 31219
Gfod2
Name: glucose-fructose oxidoreductase domain containing 2
Synonyms: 5730466C23Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 70575
Homologene: 10361
Dhrs9
Name: dehydrogenase/reductase 9
Synonyms: C730025I08Rik, dehydrogenase/reductase (SDR family) member 9, Rdh15
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241452
Homologene: 26079
Tas2r114
Name: taste receptor, type 2, member 114
Synonyms: Tas2r14, T2R14, mGR14, mt2r46
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 387346
Homologene: 128355
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 85,706,926 bp
  • T to C, chromosome 1 at 92,871,722 bp
  • C to T, chromosome 1 at 167,308,686 bp
  • T to C, chromosome 2 at 20,744,140 bp
  • T to A, chromosome 2 at 36,850,416 bp
  • T to A, chromosome 2 at 52,153,064 bp
  • C to A, chromosome 2 at 59,936,716 bp
  • T to A, chromosome 2 at 69,401,256 bp
  • A to T, chromosome 2 at 102,586,600 bp
  • T to C, chromosome 2 at 112,678,517 bp
  • T to C, chromosome 2 at 122,186,313 bp
  • A to T, chromosome 2 at 130,422,316 bp
  • A to T, chromosome 2 at 139,757,265 bp
  • T to G, chromosome 3 at 20,122,747 bp
  • T to C, chromosome 3 at 63,698,434 bp
  • T to A, chromosome 3 at 121,457,343 bp
  • A to C, chromosome 4 at 62,085,257 bp
  • C to T, chromosome 4 at 116,515,475 bp
  • A to G, chromosome 4 at 117,885,865 bp
  • T to A, chromosome 5 at 35,056,936 bp
  • T to C, chromosome 5 at 64,924,964 bp
  • C to A, chromosome 5 at 140,358,159 bp
  • T to A, chromosome 6 at 24,734,498 bp
  • T to C, chromosome 6 at 71,902,859 bp
  • T to C, chromosome 6 at 88,512,165 bp
  • T to G, chromosome 6 at 92,908,706 bp
  • T to A, chromosome 6 at 97,120,201 bp
  • T to A, chromosome 6 at 131,689,925 bp
  • T to C, chromosome 7 at 36,771,589 bp
  • G to A, chromosome 7 at 42,789,115 bp
  • A to T, chromosome 7 at 45,086,812 bp
  • A to G, chromosome 8 at 3,448,409 bp
  • T to A, chromosome 8 at 105,728,130 bp
  • T to A, chromosome 8 at 123,356,699 bp
  • T to C, chromosome 9 at 13,244,349 bp
  • T to C, chromosome 9 at 76,205,455 bp
  • A to T, chromosome 9 at 119,617,762 bp
  • T to C, chromosome 10 at 18,592,286 bp
  • T to C, chromosome 10 at 22,819,848 bp
  • G to A, chromosome 10 at 116,537,432 bp
  • G to T, chromosome 10 at 129,463,560 bp
  • T to C, chromosome 11 at 59,613,963 bp
  • T to C, chromosome 11 at 78,336,787 bp
  • A to T, chromosome 11 at 94,359,660 bp
  • GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC to GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC, chromosome 11 at 96,099,982 bp
  • C to T, chromosome 11 at 100,545,829 bp
  • T to A, chromosome 11 at 101,410,012 bp
  • T to C, chromosome 11 at 106,830,926 bp
  • A to G, chromosome 11 at 116,685,938 bp
  • A to T, chromosome 12 at 84,372,155 bp
  • T to C, chromosome 14 at 30,690,583 bp
  • A to G, chromosome 14 at 50,425,370 bp
  • A to G, chromosome 14 at 50,681,458 bp
  • T to A, chromosome 14 at 54,953,051 bp
  • G to A, chromosome 15 at 44,746,456 bp
  • A to T, chromosome 15 at 63,902,746 bp
  • T to C, chromosome 15 at 78,288,937 bp
  • G to A, chromosome 15 at 81,010,753 bp
  • G to A, chromosome 15 at 93,500,559 bp
  • A to G, chromosome 17 at 42,824,472 bp
  • A to T, chromosome 17 at 45,570,452 bp
  • T to C, chromosome 17 at 56,425,482 bp
  • T to C, chromosome 18 at 22,517,222 bp
  • A to T, chromosome 18 at 63,720,327 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7851 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045904-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.