Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7851Btlr/Mmmh
Stock Number:
045904-MU
Citation ID:
RRID:MMRRC_045904-MU
Other Names:
R7851 (G1)
Major Collection:

Strain Information

Cd2ap
Name: CD2-associated protein
Synonyms: METS-1, Mets1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12488
VEGA: 17
Homologene: 7663
Hsp90ab1
Name: heat shock protein 90 alpha (cytosolic), class B member 1
Synonyms: Hsp84, Hsp90, Hsp84-1, C81438, Hspcb
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 15516
Homologene: 74306
Arhgef18
Name: Rho/Rac guanine nucleotide exchange factor 18
Synonyms: D030053O22Rik, A430078G23Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 102098
Homologene: 32254
Cnot2
Name: CCR4-NOT transcription complex, subunit 2
Synonyms: 2600016M12Rik, 2810470K03Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 72068
HGNC: HGNC:7878
Homologene: 40953
Etl4
Name: enhancer trap locus 4
Synonyms: Etl-4, E330027G05Rik, 6620402G01Rik, 9430077C05Rik, Skt, Sickle tail
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 208618
Homologene: 10477
Wdr7
Name: WD repeat domain 7
Synonyms: TGF-beta resistance associated gene, TRAG
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 104082
VEGA: 18
Homologene: 11408
Snx8
Name: sorting nexin 8
Synonyms: B130023O14Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231834
Homologene: 8338
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 85,706,926 bp
  • T to C, chromosome 1 at 92,871,722 bp
  • C to T, chromosome 1 at 167,308,686 bp
  • T to C, chromosome 2 at 20,744,140 bp
  • T to A, chromosome 2 at 36,850,416 bp
  • T to A, chromosome 2 at 52,153,064 bp
  • C to A, chromosome 2 at 59,936,716 bp
  • T to A, chromosome 2 at 69,401,256 bp
  • A to T, chromosome 2 at 102,586,600 bp
  • T to C, chromosome 2 at 112,678,517 bp
  • T to C, chromosome 2 at 122,186,313 bp
  • A to T, chromosome 2 at 130,422,316 bp
  • A to T, chromosome 2 at 139,757,265 bp
  • T to G, chromosome 3 at 20,122,747 bp
  • T to C, chromosome 3 at 63,698,434 bp
  • T to A, chromosome 3 at 121,457,343 bp
  • A to C, chromosome 4 at 62,085,257 bp
  • C to T, chromosome 4 at 116,515,475 bp
  • A to G, chromosome 4 at 117,885,865 bp
  • T to A, chromosome 5 at 35,056,936 bp
  • T to C, chromosome 5 at 64,924,964 bp
  • C to A, chromosome 5 at 140,358,159 bp
  • T to A, chromosome 6 at 24,734,498 bp
  • T to C, chromosome 6 at 71,902,859 bp
  • T to C, chromosome 6 at 88,512,165 bp
  • T to G, chromosome 6 at 92,908,706 bp
  • T to A, chromosome 6 at 97,120,201 bp
  • T to A, chromosome 6 at 131,689,925 bp
  • T to C, chromosome 7 at 36,771,589 bp
  • G to A, chromosome 7 at 42,789,115 bp
  • A to T, chromosome 7 at 45,086,812 bp
  • A to G, chromosome 8 at 3,448,409 bp
  • T to A, chromosome 8 at 105,728,130 bp
  • T to A, chromosome 8 at 123,356,699 bp
  • T to C, chromosome 9 at 13,244,349 bp
  • T to C, chromosome 9 at 76,205,455 bp
  • A to T, chromosome 9 at 119,617,762 bp
  • T to C, chromosome 10 at 18,592,286 bp
  • T to C, chromosome 10 at 22,819,848 bp
  • G to A, chromosome 10 at 116,537,432 bp
  • G to T, chromosome 10 at 129,463,560 bp
  • T to C, chromosome 11 at 59,613,963 bp
  • T to C, chromosome 11 at 78,336,787 bp
  • A to T, chromosome 11 at 94,359,660 bp
  • GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC to GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC, chromosome 11 at 96,099,982 bp
  • C to T, chromosome 11 at 100,545,829 bp
  • T to A, chromosome 11 at 101,410,012 bp
  • T to C, chromosome 11 at 106,830,926 bp
  • A to G, chromosome 11 at 116,685,938 bp
  • A to T, chromosome 12 at 84,372,155 bp
  • T to C, chromosome 14 at 30,690,583 bp
  • A to G, chromosome 14 at 50,425,370 bp
  • A to G, chromosome 14 at 50,681,458 bp
  • T to A, chromosome 14 at 54,953,051 bp
  • G to A, chromosome 15 at 44,746,456 bp
  • A to T, chromosome 15 at 63,902,746 bp
  • T to C, chromosome 15 at 78,288,937 bp
  • G to A, chromosome 15 at 81,010,753 bp
  • G to A, chromosome 15 at 93,500,559 bp
  • A to G, chromosome 17 at 42,824,472 bp
  • A to T, chromosome 17 at 45,570,452 bp
  • T to C, chromosome 17 at 56,425,482 bp
  • T to C, chromosome 18 at 22,517,222 bp
  • A to T, chromosome 18 at 63,720,327 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7851 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045904-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.