Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7868Btlr/Mmmh
Stock Number:
045920-MU
Citation ID:
RRID:MMRRC_045920-MU
Other Names:
R7868 (G1)
Major Collection:

Strain Information

Tln2
Name: talin 2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 70549
VEGA: 9
Homologene: 56692
B4galt5
Name: UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 5
Synonyms: 9430078I07Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 56336
HGNC: HGNC:928
Homologene: 3507
Ptprz1
Name: protein tyrosine phosphatase receptor type Z, polypeptide 1
Synonyms: DSD-1-PG, phosphacan, PTPzeta, PTPbeta, Rptpbeta, Ptpz, Ptprz, RPTPz
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 19283
HGNC: HGNC:9685
Homologene: 2136
Slc1a2
Name: solute carrier family 1 (glial high affinity glutamate transporter), member 2
Synonyms: GLT1, MGLT1, Eaat2, 1700091C19Rik, GLT-1, 2900019G14Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20511
Homologene: 3075
Kdm3a
Name: lysine (K)-specific demethylase 3A
Synonyms: 1700105C21Rik, Tsga, C230043E16Rik, Jmjd1, Jmjd1a
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 104263
Homologene: 10196
Dop1a
Name: DOP1 leucine zipper like protein A
Synonyms: B130005I07Rik, D9Ertd809e, Dopey1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 320615
Homologene: 26645
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 92,460,447 bp
  • G to A, chromosome 1 at 92,608,515 bp
  • A to T, chromosome 1 at 157,099,338 bp
  • A to G, chromosome 1 at 174,368,985 bp
  • T to C, chromosome 2 at 32,683,460 bp
  • C to T, chromosome 2 at 41,449,234 bp
  • T to A, chromosome 2 at 72,201,137 bp
  • ATATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTG to ATATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTG, chromosome 2 at 76,915,806 bp
  • T to C, chromosome 2 at 77,108,412 bp
  • A to G, chromosome 2 at 102,761,185 bp
  • G to A, chromosome 2 at 118,136,486 bp
  • T to A, chromosome 2 at 129,285,289 bp
  • G to T, chromosome 2 at 167,301,420 bp
  • A to G, chromosome 3 at 54,302,286 bp
  • A to C, chromosome 3 at 146,610,274 bp
  • T to C, chromosome 4 at 99,888,957 bp
  • C to A, chromosome 4 at 116,034,132 bp
  • A to T, chromosome 4 at 122,956,855 bp
  • A to G, chromosome 4 at 130,955,000 bp
  • A to T, chromosome 4 at 139,460,033 bp
  • A to G, chromosome 4 at 143,851,584 bp
  • A to T, chromosome 5 at 30,745,416 bp
  • A to G, chromosome 5 at 114,248,227 bp
  • T to A, chromosome 5 at 137,146,777 bp
  • G to A, chromosome 6 at 23,000,964 bp
  • G to A, chromosome 6 at 37,335,869 bp
  • T to A, chromosome 6 at 53,974,760 bp
  • A to T, chromosome 6 at 71,595,489 bp
  • A to G, chromosome 6 at 84,114,099 bp
  • T to A, chromosome 6 at 85,444,315 bp
  • A to T, chromosome 7 at 28,999,962 bp
  • G to A, chromosome 7 at 96,906,380 bp
  • A to G, chromosome 7 at 102,753,605 bp
  • A to G, chromosome 8 at 54,696,267 bp
  • T to A, chromosome 9 at 39,909,986 bp
  • G to T, chromosome 9 at 56,260,470 bp
  • T to C, chromosome 9 at 57,137,986 bp
  • T to A, chromosome 9 at 58,069,091 bp
  • T to A, chromosome 9 at 65,346,979 bp
  • T to C, chromosome 9 at 67,348,226 bp
  • G to A, chromosome 9 at 86,501,984 bp
  • G to T, chromosome 9 at 108,114,899 bp
  • T to C, chromosome 10 at 13,232,609 bp
  • T to C, chromosome 10 at 62,969,864 bp
  • G to A, chromosome 11 at 22,146,542 bp
  • GTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGT to GTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGT, chromosome 11 at 43,587,430 bp
  • T to A, chromosome 11 at 74,900,332 bp
  • G to T, chromosome 12 at 55,612,638 bp
  • G to T, chromosome 12 at 87,516,618 bp
  • G to A, chromosome 12 at 100,131,187 bp
  • C to T, chromosome 13 at 24,803,399 bp
  • A to G, chromosome 14 at 30,031,331 bp
  • T to C, chromosome 14 at 33,364,516 bp
  • T to A, chromosome 14 at 44,657,297 bp
  • A to G, chromosome 14 at 68,532,641 bp
  • A to T, chromosome 14 at 73,238,995 bp
  • A to T, chromosome 15 at 58,214,590 bp
  • T to C, chromosome 16 at 87,581,212 bp
  • C to T, chromosome 17 at 40,947,043 bp
  • A to T, chromosome 17 at 74,448,052 bp
  • A to G, chromosome 18 at 4,380,673 bp
  • C to T, chromosome 19 at 3,968,492 bp
  • T to G, chromosome 19 at 33,511,568 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7868 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045920-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.