Strain Name:
C57BL/6J-MtgxR7868Btlr/Mmmh
Stock Number:
045920-MU
Citation ID:
RRID:MMRRC_045920-MU
Other Names:
R7868 (G1)
Major Collection:

Strain Information

Tln2
Name: talin 2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 70549
VEGA: 9
Homologene: 56692
B4galt5
Name: UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 5
Synonyms: 9430078I07Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 56336
HGNC: HGNC:928
Homologene: 3507
Ptprz1
Name: protein tyrosine phosphatase receptor type Z, polypeptide 1
Synonyms: DSD-1-PG, phosphacan, PTPzeta, PTPbeta, Rptpbeta, Ptpz, Ptprz, RPTPz
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 19283
HGNC: HGNC:9685
Homologene: 2136
Dysf
Name: dysferlin
Synonyms: 2310004N10Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 26903
HGNC: HGNC:3097
Homologene: 20748
Slc1a2
Name: solute carrier family 1 (glial high affinity glutamate transporter), member 2
Synonyms: GLT1, MGLT1, Eaat2, 1700091C19Rik, GLT-1, 2900019G14Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20511
Homologene: 3075
Kdm3a
Name: lysine (K)-specific demethylase 3A
Synonyms: 1700105C21Rik, Tsga, C230043E16Rik, Jmjd1, Jmjd1a
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 104263
Homologene: 10196
Dop1a
Name: DOP1 leucine zipper like protein A
Synonyms: B130005I07Rik, D9Ertd809e, Dopey1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 320615
Homologene: 26645
Lpar6
Name: lysophosphatidic acid receptor 6
Synonyms: 2610302I02Rik, P2y5, P2ry5
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 67168
Homologene: 55925
Ralgapa1
Name: Ral GTPase activating protein, alpha subunit 1
Synonyms: 4930400K19Rik, Tulip1, 2310003F20Rik, Garnl1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 56784
VEGA: 12
Homologene: 84805
Ckap2l
Name: cytoskeleton associated protein 2-like
Synonyms: 2010016H04Rik, 2610318C08Rik, Radmis
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 70466
Homologene: 51866
Smyd5
Name: SET and MYND domain containing 5
Synonyms: NN8-4AG, Rrg1, Rai15
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232187
Homologene: 6143
Ccdc141
Name: coiled-coil domain containing 141
Synonyms: ENSMUSG00000075261, CAMDI, 2610301F02Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 545428
Homologene: 52149
Fbxo32
Name: F-box protein 32
Synonyms: 4833442G10Rik, ATROGIN1, MAFbx, atrogin-1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 67731
VEGA: 15
Homologene: 12182
Tsr1
Name: TSR1 20S rRNA accumulation
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 104662
Homologene: 5576
Ubr4
Name: ubiquitin protein ligase E3 component n-recognin 4
Synonyms: A930005E13Rik, LOC381562, D930005K06Rik, 1810009A16Rik, Zubr1, p600
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 69116
Homologene: 10804
Tenm4
Name: teneurin transmembrane protein 4
Synonyms: l(7)-3Rn, Ten-m4, Doc4, l7Rn3, ELM2, Odz4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 23966
Homologene: 8034
Mfsd2a
Name: MFSD2 lysolipid transporter A, lysophospholipid
Synonyms: major facilitator superfamily domain containing 2A, 1700018O18Rik, Mfsd2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 76574
Homologene: 19229
Peak1
Name: pseudopodium-enriched atypical kinase 1
Synonyms: 1110049L02Rik, NKF3 kinase family member, C230081A13Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 244895
Homologene: 18259
Dna2
Name: DNA replication helicase/nuclease 2
Synonyms: E130315B21Rik, Dna2l
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 327762
HGNC: HGNC:2939
Homologene: 6124
Ehbp1
Name: EH domain binding protein 1
Synonyms: Flj21950, KIAA0903-like
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216565
Homologene: 22880
Nrde2
Name: nrde-2 necessary for RNA interference, domain containing
Synonyms: 6720454P05Rik, BC002230
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217827
VEGA: 12
Homologene: 41213
Eif1ad8
Name: eukaryotic translation initiation factor 1A domain containing 8
Synonyms: Gm8300
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 666806
Homologene: 103865
Map4k1
Name: mitogen-activated protein kinase kinase kinase kinase 1
Synonyms: Hpk1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 26411
HGNC: HGNC:6863
Homologene: 5199
Nlrc4
Name: NLR family, CARD domain containing 4
Synonyms: 9530011P19Rik, Card12, Ipaf
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 268973
VEGA: 17
Homologene: 10924
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Rapgef4
Name: Rap guanine nucleotide exchange factor (GEF) 4
Synonyms: Epac2, cAMP-GEFII, 1300003D15Rik, 5730402K07Rik, 6330581N18Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 56508
Homologene: 4451
Acacb
Name: acetyl-Coenzyme A carboxylase beta
Synonyms: Accb, Acc2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100705
HGNC: HGNC:85
Homologene: 74382
Wdr17
Name: WD repeat domain 17
Synonyms: 3010002I12Rik, B230207L18Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244484
Homologene: 12460
Man2c1
Name: mannosidase, alpha, class 2C, member 1
Synonyms: 1110025H24Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 73744
HGNC: HGNC:6827
Homologene: 4887
Lrp1b
Name: low density lipoprotein-related protein 1B
Synonyms: 9630004P12Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 94217
HGNC: HGNC:6693
Homologene: 56810
Efcab7
Name: EF-hand calcium binding domain 7
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230500
Homologene: 19952
Chdh
Name: choline dehydrogenase
Synonyms: D630034H06Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 218865
Homologene: 41261
Mtpap
Name: mitochondrial poly(A) polymerase
Synonyms: 0610027A18Rik, Papd1, Tent6
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 67440
VEGA: 18
Homologene: 10008
Fsip1
Name: fibrous sheath-interacting protein 1
Synonyms: 4933432K11Rik, 1700012M13Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71313
Homologene: 12390
Bsn
Name: bassoon
Synonyms: presynaptic cytomatrix protein
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12217
HGNC: HGNC:1117
Homologene: 31161
Nsun4
Name: NOL1/NOP2/Sun domain family, member 4
Synonyms: 2310010O12Rik, 2810405F18Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 72181
Homologene: 12455
BC005537
Name: cDNA sequence BC005537
Synonyms: 8030460C05Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 79555
Homologene: 11551
4933415A04Rik
Name: RIKEN cDNA 4933415A04 gene
Type: Gene
Species: Mouse
Chromosome: 11
Mmut
Name: methylmalonyl-Coenzyme A mutase
Synonyms: D230010K02Rik, Mut
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 17850
VEGA: 17
HGNC: HGNC:7526
Homologene: 20097
Or10x1
Name: olfactory receptor family 10 subfamily X member 1
Synonyms: GA_x6K02T2P20D-20787051-20786119, MOR267-11, Olfr417
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 258238
Homologene: 17358
Lipo4
Name: lipase, member O4
Synonyms: Gm6857
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 628236
Homologene: 103863
Ndufa10
Name: NADH:ubiquinone oxidoreductase subunit A10
Synonyms: 2900053E13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 67273
HGNC: HGNC:7684
Homologene: 15342
Or9s14
Name: olfactory receptor family 9 subfamily S member 14
Synonyms: GA_x6K02T2R7CC-81146179-81145211, MOR208-2, Olfr1410
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 258484
Homologene: 74205
Adam7
Name: a disintegrin and metallopeptidase domain 7
Synonyms: EAP1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 11500
HGNC: HGNC:214
Homologene: 2830
Pramel27
Name: PRAME like 27
Synonyms: Gm13103
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 194225
Homologene: 129883
Cpvl
Name: carboxypeptidase, vitellogenic-like
Synonyms: 4933436L16Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 71287
Homologene: 80235
Fpgs
Name: folylpolyglutamyl synthetase
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14287
HGNC: HGNC:3824
Homologene: 6997
Muc17
Name: mucin 17, cell surface associated
Synonyms: Muc3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 666339
Homologene: 141159
Ccdc33
Name: coiled-coil domain containing 33
Synonyms: LOC382077, 4930535E21Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 382077
Homologene: 19641
Matn1
Name: matrilin 1, cartilage matrix protein
Synonyms: matrilin-1, CMP, Crtm, Mat1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 17180
HGNC: HGNC:6907
Homologene: 1783
Arhgap22
Name: Rho GTPase activating protein 22
Synonyms: RHOGAP2, B230341L19Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 239027
Homologene: 23292
Map3k7cl
Name: Map3k7 C-terminal like
Synonyms: ORF63
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224419
Homologene: 23198
Aldh3b3
Name: aldehyde dehydrogenase 3 family, member B3
Synonyms: 1700055N04Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 73458
HGNC: HGNC:411
Homologene: 133295
Phactr2
Name: phosphatase and actin regulator 2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 215789
Homologene: 8816
Or8g2
Name: olfactory receptor family 8 subfamily G member 2
Synonyms: GA_x6K02T02EEW-227-373, GA_x6K02T2PVTD-33608180-33608971, MOR171-14, Olfr973, Olfr229
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258606
VEGA: 9
Homologene: 115513
Trpc4
Name: transient receptor potential cation channel, subfamily C, member 4
Synonyms: CCE1, Trp4, STRPC4, Trrp4
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 22066
Homologene: 22955
Dpysl5
Name: dihydropyrimidinase-like 5
Synonyms: Crmp5, CRMP-5, CRAM
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 65254
Homologene: 41347
Creb3l2
Name: cAMP responsive element binding protein 3-like 2
Synonyms: BBF2H7, C530025K05Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 208647
Homologene: 18690
Uox
Name: urate oxidase
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 22262
Homologene: 7584
Tex35
Name: testis expressed 35
Synonyms: 1700057K13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 73435
Homologene: 49980
Pdcd7
Name: programmed cell death 7
Synonyms: ES18
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 50996
VEGA: 9
HGNC: HGNC:8767
Homologene: 4170
Gm8257
Name: predicted pseudogene 8257
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 666725
Or51f23b
Name: olfactory receptor family 51 subfamily F member 23B
Synonyms: GA_x6K02T2PBJ9-5470572-5469628, MOR14-1, Olfr560
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259117
Homologene: 51824
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 92,460,447 bp
  • G to A, chromosome 1 at 92,608,515 bp
  • A to T, chromosome 1 at 157,099,338 bp
  • A to G, chromosome 1 at 174,368,985 bp
  • T to C, chromosome 2 at 32,683,460 bp
  • C to T, chromosome 2 at 41,449,234 bp
  • T to A, chromosome 2 at 72,201,137 bp
  • ATATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTG to ATATCTCTCCAGAGCCTCCCCTGGAGGAGTGGAGTATCTCTCCAGAGCCTCCCCTG, chromosome 2 at 76,915,806 bp
  • T to C, chromosome 2 at 77,108,412 bp
  • A to G, chromosome 2 at 102,761,185 bp
  • G to A, chromosome 2 at 118,136,486 bp
  • T to A, chromosome 2 at 129,285,289 bp
  • G to T, chromosome 2 at 167,301,420 bp
  • A to G, chromosome 3 at 54,302,286 bp
  • A to C, chromosome 3 at 146,610,274 bp
  • T to C, chromosome 4 at 99,888,957 bp
  • C to A, chromosome 4 at 116,034,132 bp
  • A to T, chromosome 4 at 122,956,855 bp
  • A to G, chromosome 4 at 130,955,000 bp
  • A to T, chromosome 4 at 139,460,033 bp
  • A to G, chromosome 4 at 143,851,584 bp
  • A to T, chromosome 5 at 30,745,416 bp
  • A to G, chromosome 5 at 114,248,227 bp
  • T to A, chromosome 5 at 137,146,777 bp
  • G to A, chromosome 6 at 23,000,964 bp
  • G to A, chromosome 6 at 37,335,869 bp
  • T to A, chromosome 6 at 53,974,760 bp
  • A to T, chromosome 6 at 71,595,489 bp
  • A to G, chromosome 6 at 84,114,099 bp
  • T to A, chromosome 6 at 85,444,315 bp
  • A to T, chromosome 7 at 28,999,962 bp
  • G to A, chromosome 7 at 96,906,380 bp
  • A to G, chromosome 7 at 102,753,605 bp
  • A to G, chromosome 8 at 54,696,267 bp
  • T to A, chromosome 9 at 39,909,986 bp
  • G to T, chromosome 9 at 56,260,470 bp
  • T to C, chromosome 9 at 57,137,986 bp
  • T to A, chromosome 9 at 58,069,091 bp
  • T to A, chromosome 9 at 65,346,979 bp
  • T to C, chromosome 9 at 67,348,226 bp
  • G to A, chromosome 9 at 86,501,984 bp
  • G to T, chromosome 9 at 108,114,899 bp
  • T to C, chromosome 10 at 13,232,609 bp
  • T to C, chromosome 10 at 62,969,864 bp
  • G to A, chromosome 11 at 22,146,542 bp
  • GTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGT to GTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGT, chromosome 11 at 43,587,430 bp
  • T to A, chromosome 11 at 74,900,332 bp
  • G to T, chromosome 12 at 55,612,638 bp
  • G to T, chromosome 12 at 87,516,618 bp
  • G to A, chromosome 12 at 100,131,187 bp
  • C to T, chromosome 13 at 24,803,399 bp
  • A to G, chromosome 14 at 30,031,331 bp
  • T to C, chromosome 14 at 33,364,516 bp
  • T to A, chromosome 14 at 44,657,297 bp
  • A to G, chromosome 14 at 68,532,641 bp
  • A to T, chromosome 14 at 73,238,995 bp
  • A to T, chromosome 15 at 58,214,590 bp
  • T to C, chromosome 16 at 87,581,212 bp
  • C to T, chromosome 17 at 40,947,043 bp
  • A to T, chromosome 17 at 74,448,052 bp
  • A to G, chromosome 18 at 4,380,673 bp
  • C to T, chromosome 19 at 3,968,492 bp
  • T to G, chromosome 19 at 33,511,568 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7868 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045920-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.