Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7874Btlr/Mmmh
Stock Number:
045926-MU
Citation ID:
RRID:MMRRC_045926-MU
Other Names:
R7874 (G1)
Major Collection:

Strain Information

Zdhhc17
Name: zinc finger, DHHC domain containing 17
Synonyms: A230053P19Rik, D130071N24Rik, Hip14
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 320150
VEGA: 10
Homologene: 56324
Th
Name: tyrosine hydroxylase
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 21823
Homologene: 307
Ptch2
Name: patched 2
Synonyms: ptc2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 19207
HGNC: HGNC:9586
Homologene: 37842
P4htm
Name: prolyl 4-hydroxylase, transmembrane (endoplasmic reticulum)
Synonyms: 4933406E20Rik, P4h-tm
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74443
Homologene: 41765
Ano1
Name: anoctamin 1, calcium activated chloride channel
Synonyms: Tmem16a
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101772
Homologene: 75079
Ndnf
Name: neuron-derived neurotrophic factor
Synonyms: epidermacan, A930038C07Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 68169
Homologene: 11593
Zfp273
Name: zinc finger protein 273
Synonyms: 6820416H06Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 212569
Homologene: 133729
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 106,389,873 bp
  • T to C, chromosome 2 at 5,917,674 bp
  • T to A, chromosome 2 at 79,338,637 bp
  • T to C, chromosome 2 at 112,363,833 bp
  • C to T, chromosome 2 at 163,375,842 bp
  • C to A, chromosome 3 at 6,620,141 bp
  • A to T, chromosome 3 at 30,936,714 bp
  • C to A, chromosome 3 at 62,488,631 bp
  • A to T, chromosome 3 at 64,491,032 bp
  • C to A, chromosome 3 at 76,661,786 bp
  • T to C, chromosome 4 at 43,538,041 bp
  • A to T, chromosome 4 at 43,555,606 bp
  • T to A, chromosome 4 at 47,049,275 bp
  • T to A, chromosome 4 at 60,222,420 bp
  • T to C, chromosome 4 at 106,665,684 bp
  • T to A, chromosome 4 at 117,105,964 bp
  • A to T, chromosome 5 at 34,024,350 bp
  • C to G, chromosome 5 at 93,273,343 bp
  • T to C, chromosome 5 at 125,506,207 bp
  • T to C, chromosome 5 at 137,600,028 bp
  • A to C, chromosome 5 at 145,220,866 bp
  • T to A, chromosome 6 at 48,572,145 bp
  • A to G, chromosome 6 at 48,988,666 bp
  • A to T, chromosome 6 at 65,703,429 bp
  • A to G, chromosome 6 at 103,690,263 bp
  • T to A, chromosome 6 at 122,561,949 bp
  • A to T, chromosome 7 at 19,886,438 bp
  • G to C, chromosome 7 at 141,809,303 bp
  • G to A, chromosome 7 at 142,895,571 bp
  • G to A, chromosome 7 at 144,621,724 bp
  • C to A, chromosome 8 at 21,702,796 bp
  • T to A, chromosome 9 at 14,900,579 bp
  • C to A, chromosome 9 at 65,390,302 bp
  • G to T, chromosome 9 at 108,596,949 bp
  • T to C, chromosome 10 at 39,822,495 bp
  • T to G, chromosome 10 at 79,396,511 bp
  • G to A, chromosome 10 at 94,551,027 bp
  • A to G, chromosome 10 at 97,510,194 bp
  • A to T, chromosome 10 at 110,982,117 bp
  • T to C, chromosome 11 at 58,581,747 bp
  • T to G, chromosome 11 at 59,133,276 bp
  • T to C, chromosome 11 at 72,859,653 bp
  • CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG to CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG, chromosome 11 at 115,012,431 bp
  • T to A, chromosome 12 at 59,108,588 bp
  • C to T, chromosome 12 at 112,915,946 bp
  • T to C, chromosome 13 at 23,459,215 bp
  • T to A, chromosome 13 at 33,202,671 bp
  • A to G, chromosome 13 at 37,947,124 bp
  • A to G, chromosome 13 at 67,825,439 bp
  • C to T, chromosome 13 at 100,154,951 bp
  • T to C, chromosome 13 at 100,154,960 bp
  • A to G, chromosome 13 at 102,739,275 bp
  • A to G, chromosome 14 at 20,723,149 bp
  • A to G, chromosome 14 at 24,135,619 bp
  • T to C, chromosome 15 at 73,584,335 bp
  • T to C, chromosome 15 at 102,500,642 bp
  • G to A, chromosome 17 at 23,815,678 bp
  • C to T, chromosome 17 at 32,396,707 bp
  • A to G, chromosome 17 at 34,711,443 bp
  • A to G, chromosome 18 at 64,571,024 bp
  • A to G, chromosome 18 at 78,160,768 bp
  • C to T, chromosome 19 at 4,658,423 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7874 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045926-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.