Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7874Btlr/Mmmh
Stock Number:
045926-MU
Citation ID:
RRID:MMRRC_045926-MU
Other Names:
R7874 (G1)
Major Collection:

Strain Information

Zdhhc17
Name: zinc finger, DHHC domain containing 17
Synonyms: A230053P19Rik, D130071N24Rik, Hip14
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 320150
VEGA: 10
Homologene: 56324
Th
Name: tyrosine hydroxylase
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 21823
Homologene: 307
Ptch2
Name: patched 2
Synonyms: ptc2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 19207
HGNC: HGNC:9586
Homologene: 37842
P4htm
Name: prolyl 4-hydroxylase, transmembrane (endoplasmic reticulum)
Synonyms: 4933406E20Rik, P4h-tm
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74443
Homologene: 41765
Ano1
Name: anoctamin 1, calcium activated chloride channel
Synonyms: Tmem16a
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101772
Homologene: 75079
Ndnf
Name: neuron-derived neurotrophic factor
Synonyms: epidermacan, A930038C07Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 68169
Homologene: 11593
Zfp273
Name: zinc finger protein 273
Synonyms: 6820416H06Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 212569
Homologene: 133729
Mast4
Name: microtubule associated serine/threonine kinase family member 4
Synonyms: 4930420O11Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 328329
Homologene: 42094
Srrm2
Name: serine/arginine repetitive matrix 2
Synonyms: 5033413A03Rik, SRm300
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 75956
Slc45a4
Name: solute carrier family 45, member 4
Synonyms: 9330175B01Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 106068
Homologene: 69908
Emc4
Name: ER membrane protein complex subunit 4
Synonyms: 2610318K02Rik, Tmem85
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 68032
Homologene: 5879
Zzef1
Name: zinc finger, ZZ-type with EF hand domain 1
Synonyms: 8430405D05Rik, C130099L13Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 195018
Homologene: 9027
Zkscan5
Name: zinc finger with KRAB and SCAN domains 5
Synonyms: hKraba1, Zfp95
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22757
Homologene: 8734
Map3k12
Name: mitogen-activated protein kinase kinase kinase 12
Synonyms: Zpk, DLK, MUK
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 26404
HGNC: HGNC:6851
Homologene: 4592
Rreb1
Name: ras responsive element binding protein 1
Synonyms: 1110037N09Rik, B930013M22Rik, sao
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 68750
Homologene: 2218
Ceacam19
Name: CEA cell adhesion molecule 19
Synonyms: C130022P09Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 319930
Homologene: 49621
Phlpp1
Name: PH domain and leucine rich repeat protein phosphatase 1
Synonyms: Plekhe1, Phlpp
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98432
Homologene: 11015
Dhtkd1
Name: dehydrogenase E1 and transketolase domain containing 1
Synonyms: C330018I04Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 209692
Homologene: 10278
Dcn
Name: decorin
Synonyms: DC, SLRR1B
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 13179
VEGA: 10
HGNC: HGNC:2705
Homologene: 22430
Atp8b1
Name: ATPase, class I, type 8B, member 1
Synonyms: FIC1, Ic
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 54670
VEGA: 18
HGNC: HGNC:3706
Homologene: 21151
Izumo1r
Name: IZUMO1 receptor, JUNO
Synonyms: Folbp3, 0910001L11Rik, Juno, Folr4
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 64931
Homologene: 11283
Muc5ac
Name: mucin 5, subtypes A and C, tracheobronchial/gastric
Synonyms: MGM, 2210005L13Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17833
HGNC: HGNC:7515
Homologene: 137237
Fstl5
Name: follistatin-like 5
Synonyms: 9130207J01Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 213262
Homologene: 10584
Dhx36
Name: DEAH-box helicase 36
Synonyms: Ddx36, 2810407E23Rik, RHAU
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 72162
Homologene: 6356
Aoc1l3
Name: amine oxidase copper containing 1-like 3
Synonyms: SVS I, Svs1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243377
HGNC: HGNC:80
Homologene: 18250
Naip2
Name: NLR family, apoptosis inhibitory protein 2
Synonyms: Naip2, Naip-rs6, Birc1b
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17948
HGNC: HGNC:7634
Homologene: 136092
Obscn
Name: obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF
Synonyms: LOC380698, OTTMUSG00000005786
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380698
Homologene: 70869
Tnxb
Name: tenascin XB
Synonyms: Tnx, TN-MHC
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 81877
Homologene: 49589
Rasal3
Name: RAS protein activator like 3
Synonyms: A430107D22Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 320484
Homologene: 18901
Chl1
Name: cell adhesion molecule L1-like
Synonyms: CALL, A530023M13Rik, close homolog of L1, LICAM2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12661
HGNC: HGNC:1939
Homologene: 21314
Vmn2r5
Name: vomeronasal 2, receptor 5
Synonyms: EG667060
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 667060
Btn1a1
Name: butyrophilin, subfamily 1, member A1
Synonyms: Btn
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 12231
HGNC: HGNC:1135
Homologene: 1312
Rev3l
Name: REV3 like, DNA directed polymerase zeta catalytic subunit
Synonyms: Sez4, Rev
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19714
HGNC: HGNC:9968
Homologene: 48147
Jag2
Name: jagged 2
Synonyms: Serh, D12Ggc2e
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 16450
VEGA: 12
HGNC: HGNC:6189
Homologene: 1677
Cerkl
Name: ceramide kinase-like
Synonyms: Rp26
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228094
Homologene: 52396
Vmn2r82
Name: vomeronasal 2, receptor 82
Synonyms: EG624845
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 624845
Homologene: 83483
Zswim8
Name: zinc finger SWIM-type containing 8
Synonyms: 4832404P21Rik, 2310021P13Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 268721
VEGA: 14
Homologene: 34313
Dlg5
Name: discs large MAGUK scaffold protein 5
Synonyms: 4933429D20Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 71228
HGNC: HGNC:2904
Homologene: 3486
Tmcc3
Name: transmembrane and coiled coil domains 3
Synonyms: C630016B22Rik, LOC380656, A230066D03Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 319880
Homologene: 10792
Slc14a2
Name: solute carrier family 14 (urea transporter), member 2
Synonyms: UT-A3, UT-A5
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 27411
VEGA: 18
Homologene: 5183
Serpinb9d
Name: serine (or cysteine) peptidase inhibitor, clade B, member 9d
Synonyms: ovalbumin, Spi9, AT2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20726
HGNC: HGNC:8955
Homologene: 69093
Aacs
Name: acetoacetyl-CoA synthetase
Synonyms: 2210408B16Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 78894
Homologene: 11322
Ttc4
Name: tetratricopeptide repeat domain 4
Synonyms: L62, 2810002P21Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 72354
Homologene: 31249
Mospd3
Name: motile sperm domain containing 3
Synonyms: R124, 5133401H10Rik, 1190005J19Rik, Gtig2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 68929
Homologene: 11406
Top6bl
Name: TOP6B like initiator of meiotic double strand breaks
Synonyms: Top6bl, Gm960
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 381196
VEGA: 19
Homologene: 69381
Cd300ld2
Name: CD300 molecule like family member D2
Synonyms: Gm11709
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 629970
Or2t46
Name: olfactory receptor family 2 subfamily T member 46
Synonyms: GA_x6K02T2NKPP-844642-843680, MOR275-5, MOR275-11_p, Olfr325
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258261
Homologene: 133015
Anks6
Name: ankyrin repeat and sterile alpha motif domain containing 6
Synonyms: LOC269533, 2210417J20Rik, Samd6, SamCystin, b2b1801.1Clo
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 75691
Homologene: 19545
Rarres2
Name: retinoic acid receptor responder (tazarotene induced) 2
Synonyms: 0610007L05Rik, chemerin
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 71660
HGNC: HGNC:9868
Homologene: 2167
Phc3
Name: polyhomeotic 3
Synonyms: EDR3, HPH3, E030046K01Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 241915
Homologene: 69390
Aicda
Name: activation-induced cytidine deaminase
Synonyms: Aid
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 11628
Homologene: 7623
Jph2
Name: junctophilin 2
Synonyms: JP-2, 1110002E14Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 59091
Homologene: 10714
Kbtbd13
Name: kelch repeat and BTB (POZ) domain containing 13
Synonyms: 5430433E21Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74492
Homologene: 19285
Defa39
Name: defensin, alpha, 39
Synonyms: CRS1C-3, AY761184
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 382000
Homologene: 85974
Mup8
Name: major urinary protein 8
Synonyms: Gm12809
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100041687
Homologene: 74304
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 106,389,873 bp
  • T to C, chromosome 2 at 5,917,674 bp
  • T to A, chromosome 2 at 79,338,637 bp
  • T to C, chromosome 2 at 112,363,833 bp
  • C to T, chromosome 2 at 163,375,842 bp
  • C to A, chromosome 3 at 6,620,141 bp
  • A to T, chromosome 3 at 30,936,714 bp
  • C to A, chromosome 3 at 62,488,631 bp
  • A to T, chromosome 3 at 64,491,032 bp
  • C to A, chromosome 3 at 76,661,786 bp
  • T to C, chromosome 4 at 43,538,041 bp
  • A to T, chromosome 4 at 43,555,606 bp
  • T to A, chromosome 4 at 47,049,275 bp
  • T to A, chromosome 4 at 60,222,420 bp
  • T to C, chromosome 4 at 106,665,684 bp
  • T to A, chromosome 4 at 117,105,964 bp
  • A to T, chromosome 5 at 34,024,350 bp
  • C to G, chromosome 5 at 93,273,343 bp
  • T to C, chromosome 5 at 125,506,207 bp
  • T to C, chromosome 5 at 137,600,028 bp
  • A to C, chromosome 5 at 145,220,866 bp
  • T to A, chromosome 6 at 48,572,145 bp
  • A to G, chromosome 6 at 48,988,666 bp
  • A to T, chromosome 6 at 65,703,429 bp
  • A to G, chromosome 6 at 103,690,263 bp
  • T to A, chromosome 6 at 122,561,949 bp
  • A to T, chromosome 7 at 19,886,438 bp
  • G to C, chromosome 7 at 141,809,303 bp
  • G to A, chromosome 7 at 142,895,571 bp
  • G to A, chromosome 7 at 144,621,724 bp
  • C to A, chromosome 8 at 21,702,796 bp
  • T to A, chromosome 9 at 14,900,579 bp
  • C to A, chromosome 9 at 65,390,302 bp
  • G to T, chromosome 9 at 108,596,949 bp
  • T to C, chromosome 10 at 39,822,495 bp
  • T to G, chromosome 10 at 79,396,511 bp
  • G to A, chromosome 10 at 94,551,027 bp
  • A to G, chromosome 10 at 97,510,194 bp
  • A to T, chromosome 10 at 110,982,117 bp
  • T to C, chromosome 11 at 58,581,747 bp
  • T to G, chromosome 11 at 59,133,276 bp
  • T to C, chromosome 11 at 72,859,653 bp
  • CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG to CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG, chromosome 11 at 115,012,431 bp
  • T to A, chromosome 12 at 59,108,588 bp
  • C to T, chromosome 12 at 112,915,946 bp
  • T to C, chromosome 13 at 23,459,215 bp
  • T to A, chromosome 13 at 33,202,671 bp
  • A to G, chromosome 13 at 37,947,124 bp
  • A to G, chromosome 13 at 67,825,439 bp
  • C to T, chromosome 13 at 100,154,951 bp
  • T to C, chromosome 13 at 100,154,960 bp
  • A to G, chromosome 13 at 102,739,275 bp
  • A to G, chromosome 14 at 20,723,149 bp
  • A to G, chromosome 14 at 24,135,619 bp
  • T to C, chromosome 15 at 73,584,335 bp
  • T to C, chromosome 15 at 102,500,642 bp
  • G to A, chromosome 17 at 23,815,678 bp
  • C to T, chromosome 17 at 32,396,707 bp
  • A to G, chromosome 17 at 34,711,443 bp
  • A to G, chromosome 18 at 64,571,024 bp
  • A to G, chromosome 18 at 78,160,768 bp
  • C to T, chromosome 19 at 4,658,423 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7874 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045926-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.