Strain Name:
C57BL/6J-MtgxR7883Btlr/Mmmh
Stock Number:
045935-MU
Citation ID:
RRID:MMRRC_045935-MU
Other Names:
R7883 (G1)
Major Collection:

Strain Information

Itpk1
Name: inositol 1,3,4-triphosphate 5/6 kinase
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217837
HGNC: HGNC:6177
Homologene: 8588
Chd7
Name: chromodomain helicase DNA binding protein 7
Synonyms: GENA 60, GENA 47, Gena 52, Cyn, A730019I05Rik, WBE1, Whi, Todo, Obt, Mt, Lda, Flo, Edy, Dz, Cycn
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 320790
Homologene: 19067
Fzr1
Name: fizzy and cell division cycle 20 related 1
Synonyms: Fyr, Cdh1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 56371
Homologene: 9444
Tkfc
Name: triokinase, FMN cyclase
Synonyms: Dak
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 225913
VEGA: 19
Homologene: 56710
Patj
Name: PATJ, crumbs cell polarity complex component
Synonyms: Cipp, Inadl
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12695
Homologene: 72199
Dab2ip
Name: disabled 2 interacting protein
Synonyms: 2310011D08Rik, AIP1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 69601
Homologene: 13058
Cpt1c
Name: carnitine palmitoyltransferase 1c
Synonyms: CPT I-C, 9630004I06Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 78070
Homologene: 17561
Bms1
Name: BMS1, ribosome biogenesis factor
Synonyms: Bms1l
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 213895
Homologene: 7065
Taf4
Name: TATA-box binding protein associated factor 4
Synonyms: TAFII135, TAFII130, Taf2c1, Taf4a
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228980
Homologene: 55723
Aspm
Name: abnormal spindle microtubule assembly
Synonyms: Sha1, Aspm, D330028K02Rik, MCPH5, Calmbp1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12316
Homologene: 7650
Med25
Name: mediator complex subunit 25
Synonyms: ESTM2, 2610529E18Rik, 2610034E13Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 75613
Homologene: 12614
Atxn2
Name: ataxin 2
Synonyms: ATX2, 9630045M23Rik, Sca2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20239
Homologene: 2234
Dmtf1
Name: cyclin D binding myb like transcription factor 1
Synonyms: Dmp1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 23857
Homologene: 8017
Pik3c3
Name: phosphatidylinositol 3-kinase catalytic subunit type 3
Synonyms: Vps34, 5330434F23Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225326
HGNC: HGNC:8974
Homologene: 1986
Ppp1r8
Name: protein phosphatase 1, regulatory subunit 8
Synonyms: 6330548N22Rik, NIPP1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100336
HGNC: HGNC:9296
Homologene: 8555
Cttn
Name: cortactin
Synonyms: Ems1, 1110020L01Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13043
HGNC: HGNC:3338
Homologene: 3834
Zfp799
Name: zinc finger protein 799
Synonyms: 6030490I01Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240064
Homologene: 107106
Fgfr3
Name: fibroblast growth factor receptor 3
Synonyms: HBGFR, Fgfr-3, sam3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14184
HGNC: HGNC:3690
Homologene: 55437
Dync2h1
Name: dynein cytoplasmic 2 heavy chain 1
Synonyms: DHC1b, DHC2, 4432416O06Rik, D330044F14Rik, D030010H02Rik, Dnchc2, b2b414Clo, m407Asp, m152Asp
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 110350
HGNC: HGNC:2962
Homologene: 14468
Cep152
Name: centrosomal protein 152
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 99100
Homologene: 37159
Ppan
Name: peter pan homolog
Synonyms: SSF1, A230087P06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235036
Homologene: 5690
Exoc1
Name: exocyst complex component 1
Synonyms: Sec3p, SEC3, A730011E05Rik, 2810407P21Rik, Sec3l1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 69940
Homologene: 41241
Tctn1
Name: tectonic family member 1
Synonyms: Tect1, G730031O11Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 654470
Homologene: 49770
Pdgfd
Name: platelet-derived growth factor, D polypeptide
Synonyms: 1110003I09Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 71785
VEGA: 9
Homologene: 11875
Arl13b
Name: ADP-ribosylation factor-like 13B
Synonyms: A930014M17Rik, A530097K21Rik, C530009C10Rik, Arl2l1, hnn
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 68146
Homologene: 18820
Abcb6
Name: ATP-binding cassette, sub-family B member 6
Synonyms: 1200005B17Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74104
HGNC: HGNC:47
Homologene: 11375
Tulp3
Name: TUB like protein 3
Synonyms: 2310022L06Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 22158
Homologene: 20711
Psmd5
Name: proteasome (prosome, macropain) 26S subunit, non-ATPase, 5
Synonyms: 1500032A03Rik, S5b
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66998
HGNC: HGNC:9563
Homologene: 37999
Pkp1
Name: plakophilin 1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18772
HGNC: HGNC:9023
Homologene: 253
Camta2
Name: calmodulin binding transcription activator 2
Synonyms: Kiaa0909-hp
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216874
Homologene: 9021
Fat2
Name: FAT atypical cadherin 2
Synonyms: LOC245827, mKIAA0811, Fath2, EMI2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 245827
HGNC: HGNC:3596
Homologene: 1110
Fbxw18
Name: F-box and WD-40 domain protein 18
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 546161
Homologene: 110776
Ppih
Name: peptidyl prolyl isomerase H
Synonyms: 4833408F11Rik, 1100001J08Rik, 2010111B15Rik, cyclophilin H, rotamase H, CYP-20, D4Wsu43e
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 66101
Homologene: 38172
Pkhd1l1
Name: polycystic kidney and hepatic disease 1-like 1
Synonyms: D86 mRNA, PKHDL1, fibrocystin L
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 192190
Homologene: 16332
Zhx2
Name: zinc fingers and homeoboxes 2
Synonyms: Raf, Afr-1, Afr1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 387609
Homologene: 8968
Gcnt3
Name: glucosaminyl (N-acetyl) transferase 3, mucin type
Synonyms: 2010013H22Rik, 2210021I22Rik, 2210401J11Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 72077
VEGA: 9
HGNC: HGNC:4205
Homologene: 20993
Sis
Name: sucrase isomaltase
Synonyms: Si-s, sucrase-isomaltase, 2010204N08Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 69983
Homologene: 37424
Fat4
Name: FAT atypical cadherin 4
Synonyms: 6030410K14Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 329628
Homologene: 14377
Nwd1
Name: NACHT and WD repeat domain containing 1
Synonyms: A230063L24Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 319555
Homologene: 72261
Lrp1b
Name: low density lipoprotein-related protein 1B
Synonyms: 9630004P12Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 94217
HGNC: HGNC:6693
Homologene: 56810
Tpo
Name: thyroid peroxidase
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 22018
Homologene: 461
Obscn
Name: obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF
Synonyms: LOC380698, OTTMUSG00000005786
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380698
Homologene: 70869
Hsd3b5
Name: hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 5
Synonyms: 3(beta)HSDV
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 15496
Homologene: 104115
Ptprn
Name: protein tyrosine phosphatase receptor type N
Synonyms: IA-2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19275
HGNC: HGNC:9676
Homologene: 48142
Tulp2
Name: TUB like protein 2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 56734
Homologene: 2492
Pth1r
Name: parathyroid hormone 1 receptor
Synonyms: PTH-related peptide receptor, PPR, PTH1R, PTH/PTHrP receptor, Pthr1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 19228
HGNC: HGNC:9608
Homologene: 267
Rgl3
Name: ral guanine nucleotide dissociation stimulator-like 3
Synonyms: 1300003D20Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 71746
VEGA: 9
Homologene: 11363
Krt18
Name: keratin 18
Synonyms: K18, Endo B, Krt1-18, CK18
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 16668
VEGA: 15
HGNC: HGNC:6430
Homologene: 55448
Adrb2
Name: adrenergic receptor, beta 2
Synonyms: beta 2-AR, Badm, Adrb-2, beta 2-adrenoceptor, Gpcr7
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 11555
VEGA: 18
HGNC: HGNC:286
Homologene: 30948
Map1a
Name: microtubule-associated protein 1 A
Synonyms: Mtap-1, Mtap1, 6330416M19Rik, Mtap1a
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17754
HGNC: HGNC:6835
Homologene: 1778
St6galnac6
Name: ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 6
Synonyms: ST6GalNAcVI, Siat7f
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 50935
Homologene: 8390
Mertk
Name: MER proto-oncogene tyrosine kinase
Synonyms: Tyro 12, Nyk, Eyk, Mer, nmf12
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17289
HGNC: HGNC:7027
Homologene: 4626
Hid1
Name: HID1 domain containing
Synonyms: C630004H02Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217310
Homologene: 12737
Tmem270
Name: transmembrane protein 270
Synonyms: 1700111I05Rik, Wbscr28
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 76629
Homologene: 18790
Atp8b5
Name: ATPase, class I, type 8B, member 5
Synonyms: FetA, 4930417M19Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 320571
Homologene: 99882
Tufm
Name: Tu translation elongation factor, mitochondrial
Synonyms: EF-TuMT, 2300002G02Rik, C76308
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233870
Homologene: 2490
Pdzd7
Name: PDZ domain containing 7
Synonyms: Pdzk7, EG435601
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 100503041
Homologene: 129509
Kcnt2
Name: potassium channel, subfamily T, member 2
Synonyms: E330038N15Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240776
Homologene: 16121
Vill
Name: villin-like
Synonyms: Villp
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 22351
Homologene: 22650
C1ra
Name: complement component 1, r subcomponent A
Synonyms: mC1rA
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 50909
HGNC: HGNC:1246
Homologene: 1313
Sfxn4
Name: sideroflexin 4
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 94281
Homologene: 14228
Slc22a16
Name: solute carrier family 22 (organic cation transporter), member 16
Synonyms: FLIPT2, OKB1, OCT6, CT2, 4921504E14Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70840
Homologene: 41957
Abcc10
Name: ATP-binding cassette, sub-family C member 10
Synonyms: Mrp7
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224814
HGNC: HGNC:52
Homologene: 58616
Klhl36
Name: kelch-like 36
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234796
Homologene: 32598
Arhgap45
Name: Rho GTPase activating protein 45
Synonyms: 6330406L22Rik, Hmha1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70719
Homologene: 69120
Grid1
Name: glutamate receptor, ionotropic, delta 1
Synonyms: GluRdelta1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 14803
HGNC: HGNC:4575
Homologene: 69017
Cd300ld2
Name: CD300 molecule like family member D2
Synonyms: Gm11709
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 629970
Lats2
Name: large tumor suppressor 2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 50523
HGNC: HGNC:6515
Homologene: 56678
Gm10577
Name: predicted gene 10577
Type: Gene
Species: Mouse
Chromosome: 4
Smpd1
Name: sphingomyelin phosphodiesterase 1, acid lysosomal
Synonyms: A-SMase, aSMase, ASM, acid sphingomyelinase, Zn-SMase
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20597
Homologene: 457
Spata6l
Name: spermatogenesis associated 6 like
Synonyms: 4430402I18Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 381218
Homologene: 128454
Apol11a
Name: apolipoprotein L 11a
Synonyms: EG626615
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 626615
VEGA: 15
HGNC: HGNC:618
Homologene: 129975
Uqcrc2
Name: ubiquinol cytochrome c reductase core protein 2
Synonyms: 1500004O06Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 67003
Homologene: 37764
Pgpep1l
Name: pyroglutamyl-peptidase I-like
Synonyms: C330024D12Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 78444
Homologene: 25138
Iqcj
Name: IQ motif containing J
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 208426
Homologene: 132095
Slc25a10
Name: solute carrier family 25 (mitochondrial carrier, dicarboxylate transporter), member 10
Synonyms: Dic
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 27376
Homologene: 6519
Gm826
Name: predicted gene 826
Synonyms: LOC329554, Gm46773
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 329554
Sds
Name: serine dehydratase
Synonyms: SDH
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231691
Homologene: 38235
Pcdha8
Name: protocadherin alpha 8
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 353235
HGNC: HGNC:8675
Homologene: 129614
Mrps12
Name: mitochondrial ribosomal protein S12
Synonyms: rps12, mitoribosomal protein s12, Rpms12
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 24030
Homologene: 6848
1110065P20Rik
Name: RIKEN cDNA 1110065P20 gene
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 68920
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 75,178,016 bp
  • A to T, chromosome 1 at 75,262,363 bp
  • A to G, chromosome 1 at 135,884,903 bp
  • A to G, chromosome 1 at 139,478,667 bp
  • A to G, chromosome 1 at 140,523,150 bp
  • A to G, chromosome 2 at 32,614,929 bp
  • T to A, chromosome 2 at 34,856,512 bp
  • G to A, chromosome 2 at 35,720,206 bp
  • A to T, chromosome 2 at 40,665,129 bp
  • A to G, chromosome 2 at 121,305,372 bp
  • G to A, chromosome 2 at 125,613,058 bp
  • A to G, chromosome 2 at 128,776,345 bp
  • A to G, chromosome 2 at 160,327,293 bp
  • G to T, chromosome 2 at 179,929,295 bp
  • G to A, chromosome 3 at 38,981,819 bp
  • A to G, chromosome 3 at 68,047,308 bp
  • A to T, chromosome 3 at 72,920,996 bp
  • A to G, chromosome 3 at 98,622,140 bp
  • A to G, chromosome 4 at 8,826,504 bp
  • A to G, chromosome 4 at 43,342,471 bp
  • G to A, chromosome 4 at 98,611,135 bp
  • A to T, chromosome 4 at 101,020,522 bp
  • C to A, chromosome 4 at 119,310,790 bp
  • A to T, chromosome 4 at 124,850,647 bp
  • G to T, chromosome 4 at 132,834,715 bp
  • T to C, chromosome 5 at 9,140,397 bp
  • T to A, chromosome 5 at 33,733,891 bp
  • T to A, chromosome 5 at 76,561,382 bp
  • A to G, chromosome 5 at 120,479,213 bp
  • A to G, chromosome 5 at 121,802,117 bp
  • A to G, chromosome 5 at 122,264,312 bp
  • A to G, chromosome 5 at 134,902,827 bp
  • G to T, chromosome 6 at 118,388,774 bp
  • G to A, chromosome 6 at 124,517,725 bp
  • G to A, chromosome 6 at 128,326,844 bp
  • A to G, chromosome 7 at 28,740,143 bp
  • A to G, chromosome 7 at 44,891,808 bp
  • A to T, chromosome 7 at 44,964,014 bp
  • A to G, chromosome 7 at 45,516,764 bp
  • G to A, chromosome 7 at 68,239,149 bp
  • T to C, chromosome 7 at 105,556,985 bp
  • A to G, chromosome 7 at 120,645,217 bp
  • T to C, chromosome 7 at 126,488,942 bp
  • C to T, chromosome 7 at 144,445,818 bp
  • T to A, chromosome 8 at 72,667,126 bp
  • T to C, chromosome 8 at 119,874,478 bp
  • T to A, chromosome 9 at 6,293,939 bp
  • T to C, chromosome 9 at 7,005,566 bp
  • T to A, chromosome 9 at 20,891,481 bp
  • T to C, chromosome 9 at 21,981,427 bp
  • T to A, chromosome 9 at 70,034,171 bp
  • A to G, chromosome 9 at 109,688,406 bp
  • T to C, chromosome 9 at 110,731,558 bp
  • C to A, chromosome 9 at 119,065,521 bp
  • T to G, chromosome 10 at 40,603,664 bp
  • T to A, chromosome 10 at 80,027,589 bp
  • G to A, chromosome 10 at 81,368,635 bp
  • T to C, chromosome 11 at 55,253,364 bp
  • G to A, chromosome 11 at 59,070,009 bp
  • T to C, chromosome 11 at 70,675,211 bp
  • CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG to CGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGGCAGAACTGTGGATGTCAGAACTGTGGATGTCAGAACTGTGGATGGCACAACTGTGCATGGCAGAACTGTGGATGGCACAACTGTGGATGGCAGAACTGTGG, chromosome 11 at 115,012,431 bp
  • T to A, chromosome 11 at 115,354,609 bp
  • T to A, chromosome 11 at 120,494,514 bp
  • T to C, chromosome 12 at 30,103,170 bp
  • A to G, chromosome 12 at 102,606,175 bp
  • T to G, chromosome 14 at 35,450,302 bp
  • T to C, chromosome 14 at 57,697,200 bp
  • A to T, chromosome 15 at 44,529,126 bp
  • A to G, chromosome 15 at 57,821,874 bp
  • A to G, chromosome 15 at 77,516,574 bp
  • G to A, chromosome 15 at 102,028,450 bp
  • A to T, chromosome 16 at 62,827,266 bp
  • A to G, chromosome 17 at 32,820,282 bp
  • A to G, chromosome 17 at 46,307,101 bp
  • T to C, chromosome 18 at 30,274,363 bp
  • T to A, chromosome 18 at 36,993,143 bp
  • A to G, chromosome 18 at 62,179,376 bp
  • A to T, chromosome 19 at 10,595,030 bp
  • A to C, chromosome 19 at 28,928,613 bp
  • A to C, chromosome 19 at 45,030,240 bp
  • A to T, chromosome 19 at 60,858,749 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7883 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045935-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.