Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7897Btlr/Mmmh
Stock Number:
045949-MU
Citation ID:
RRID:MMRRC_045949-MU
Other Names:
R7897 (G1)
Major Collection:

Strain Information

Elavl3
Name: ELAV like RNA binding protein 3
Synonyms: mHuC, Huc, 2600009P04Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 15571
VEGA: 9
HGNC: HGNC:3314
Homologene: 31035
Sox9
Name: SRY (sex determining region Y)-box 9
Synonyms: 2010306G03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20682
Homologene: 294
Pik3cd
Name: phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit delta
Synonyms: p110delta, 2410099E07Rik, 2610208K16Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18707
HGNC: HGNC:8977
Homologene: 3686
Kcna6
Name: potassium voltage-gated channel, shaker-related, subfamily, member 6
Synonyms: Kv1.6, MK1.6
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16494
HGNC: HGNC:6225
Homologene: 1684
Jmjd1c
Name: jumonji domain containing 1C
Synonyms: TRIP8, 5430433L24Rik, D630035I23Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 108829
Homologene: 3129
Rictor
Name: RPTOR independent companion of MTOR, complex 2
Synonyms: 6030405M08Rik, D530039E11Rik, 4921505C17Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 78757
VEGA: 15
Homologene: 34317
Vps54
Name: VPS54 GARP complex subunit
Synonyms: Vps54l, 5330404P15Rik, mSLP8, wr
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 245944
Homologene: 5605
Itsn1
Name: intersectin 1 (SH3 domain protein 1A)
Synonyms: Ese1, EHSH1, Sh3p17, Eh domain, SH3 domain regulator of endocytosis 1, Intersectin-L
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 16443
HGNC: HGNC:6183
Homologene: 2277
Usp48
Name: ubiquitin specific peptidase 48
Synonyms: D330022K21Rik, 2810449C13Rik, Usp31
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 170707
Homologene: 12988
Zmym4
Name: zinc finger, MYM-type 4
Synonyms: 6330503C17Rik, Zfp262
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 67785
Homologene: 35470
Zfp106
Name: zinc finger protein 106
Synonyms: Cd-1, H3a, sirm, Sh3bp3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20402
Homologene: 40787
Kpna1
Name: karyopherin subunit alpha 1
Synonyms: mSRP1, m-importin-alpha-S1, Rch2, NPI1, importin alpha 5
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 16646
HGNC: HGNC:6394
Homologene: 55642
Ap5m1
Name: adaptor-related protein complex 5, mu 1 subunit
Synonyms: 4932432K03Rik, Mudeng
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 74385
VEGA: 14
Homologene: 10081
Tlr4
Name: toll-like receptor 4
Synonyms: Lps, Rasl2-8, lipopolysaccharide response
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 21898
Homologene: 41317
Robo2
Name: roundabout guidance receptor 2
Synonyms: 9430089E08Rik, D230004I22Rik, 2600013A04Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 268902
Homologene: 43188
Klhl12
Name: kelch-like 12
Synonyms: C3ip1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240756
Homologene: 23317
Jph3
Name: junctophilin 3
Synonyms: JP-3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 57340
Homologene: 10762
Cul7
Name: cullin 7
Synonyms: p193, 2510004L20Rik, p185, C230011P08Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 66515
Homologene: 56683
Galr1
Name: galanin receptor 1
Synonyms: Galnr1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 14427
VEGA: 18
HGNC: HGNC:4132
Homologene: 74396
Bcl9
Name: B cell CLL/lymphoma 9
Synonyms: 8030475K17Rik, A330041G23Rik, 2610202E01Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 77578
HGNC: HGNC:1008
Homologene: 3191
Pgap1
Name: post-GPI attachment to proteins 1
Synonyms: 5033403E17Rik, 9030223K07Rik, D230012E17Rik, PGAP1, oto
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241062
Homologene: 41605
Csmd1
Name: CUB and Sushi multiple domains 1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 94109
Homologene: 69536
Cfap74
Name: cilia and flagella associated protein 74
Synonyms: 2010015L04Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 544678
Homologene: 129584
Unc13b
Name: unc-13 homolog B
Synonyms: Unc13h2, Munc13-2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 22249
Homologene: 31376
Ptprq
Name: protein tyrosine phosphatase receptor type Q
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237523
HGNC: HGNC:9679
Homologene: 83557
Sdk2
Name: sidekick cell adhesion molecule 2
Synonyms: 5330435L01Rik, 4632412F08Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237979
Homologene: 10406
Afm
Name: afamin
Synonyms: Alf, alpha albumin
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 280662
HGNC: HGNC:316
Homologene: 881
Ppfia2
Name: protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2
Synonyms: E130120L08Rik, Liprin-alpha2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 327814
VEGA: 10
HGNC: HGNC:9246
Homologene: 27953
Gm11639
Name: predicted gene 11639
Synonyms: Gm11639, Efcab15
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 105242472
Abcb11
Name: ATP-binding cassette, sub-family B member 11
Synonyms: PFIC2, ABC16, PGY4, Lith1, sister of P-glycoprotein, Bsep
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 27413
HGNC: HGNC:42
Homologene: 74509
Bsn
Name: bassoon
Synonyms: presynaptic cytomatrix protein
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12217
HGNC: HGNC:1117
Homologene: 31161
Grm5
Name: glutamate receptor, metabotropic 5
Synonyms: mGluR5, Gprc1e, 6430542K11Rik, Glu5R
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 108071
HGNC: HGNC:4597
Homologene: 37354
Col6a5
Name: collagen, type VI, alpha 5
Synonyms: Col6a5, Gm7455
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 665033
Homologene: 122792
Atp13a4
Name: ATPase type 13A4
Synonyms: 4631413J11Rik, 9330174J19Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224079
Homologene: 75330
Nol4
Name: nucleolar protein 4
Synonyms: 4930568N03Rik, LOC383304, 1700013J13Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 319211
HGNC: HGNC:7870
Homologene: 36142
Psg23
Name: pregnancy-specific beta-1-glycoprotein 23
Synonyms: 1620401C02Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 56868
Homologene: 110989
Pkd1l2
Name: polycystic kidney disease 1 like 2
Synonyms: 1700126L06Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 76645
Homologene: 124481
Clip1
Name: CAP-GLY domain containing linker protein 1
Synonyms: cytoplasmic linker protein 50, Clip50, CLIP-170, 1110007I12Rik, 4631429H07Rik, Rsn, restin, Clip 170
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 56430
Homologene: 74455
Pde8b
Name: phosphodiesterase 8B
Synonyms: B230331L10Rik, C030047E14Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218461
HGNC: HGNC:8794
Homologene: 2758
Abcc10
Name: ATP-binding cassette, sub-family C member 10
Synonyms: Mrp7
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224814
HGNC: HGNC:52
Homologene: 58616
Fam184a
Name: family with sequence similarity 184, member A
Synonyms: 3110012E06Rik, 4930438C08Rik, 4930589M24Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 75906
Homologene: 11600
Actr3b
Name: ARP3 actin-related protein 3B
Synonyms: ARP11, Arp3b
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 242894
Homologene: 4180
Pdia2
Name: protein disulfide isomerase associated 2
Synonyms: 1810041F13Rik, Pdipl, Pdip
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 69191
Homologene: 55994
Armcx5
Name: armadillo repeat containing, X-linked 5
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 494468
Homologene: 128366
Ahr
Name: aryl-hydrocarbon receptor
Synonyms: dioxin receptor, Ahh, Ah, In, Ahre, bHLHe76
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 11622
HGNC: HGNC:348
Homologene: 1224
Kcne3
Name: potassium voltage-gated channel, Isk-related subfamily, gene 3
Synonyms: MiRP2, 2210017H05Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 57442
HGNC: HGNC:6243
Homologene: 3994
Crisp1
Name: cysteine-rich secretory protein 1
Synonyms: CRISP-1, Aeg1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 11571
Homologene: 135665
Pla2g12b
Name: phospholipase A2, group XIIB
Synonyms: 2010002E04Rik, Pla2g13, hlb218
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 69836
Homologene: 11356
Glyatl3
Name: glycine-N-acyltransferase-like 3
Synonyms: Gm5683
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 435528
VEGA: 17
Homologene: 19824
Nudt16l2
Name: nudix hydrolase 16 like 2
Synonyms: 1700080E11Rik, nudix (nucleoside diphosphate linked moiety X)-type motif 16-like 2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 73532
Homologene: 87061
Zscan2
Name: zinc finger and SCAN domain containing 2
Synonyms: Zfp-29, Zfp29
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22691
Homologene: 56453
Krtap31-1
Name: keratin associated protein 31-1
Synonyms: 4733401H21Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 70831
Homologene: 134336
Fbxo3
Name: F-box protein 3
Synonyms: Fba, 1700026K02Rik, 1200002G09Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 57443
Homologene: 8133
Gm5145
Name: predicted pseudogene 5145
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 381065
VEGA: 17
Ms4a12
Name: membrane-spanning 4-domains, subfamily A, member 12
Synonyms: LOC381213
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 381213
Homologene: 130690
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 54,551,008 bp
  • A to T, chromosome 1 at 134,458,481 bp
  • TGTTGATCCATA to T, chromosome 2 at 69,323,872 bp
  • GTTGATCCATACA to G, chromosome 2 at 69,323,873 bp
  • A to G, chromosome 2 at 104,053,412 bp
  • G to A, chromosome 2 at 120,535,615 bp
  • T to C, chromosome 2 at 181,081,141 bp
  • A to G, chromosome 3 at 97,205,251 bp
  • A to G, chromosome 4 at 43,171,860 bp
  • A to G, chromosome 4 at 66,839,821 bp
  • A to T, chromosome 4 at 126,889,539 bp
  • A to T, chromosome 4 at 137,644,428 bp
  • T to A, chromosome 4 at 149,657,269 bp
  • T to C, chromosome 4 at 155,429,894 bp
  • T to C, chromosome 5 at 25,831,659 bp
  • G to A, chromosome 5 at 90,547,868 bp
  • C to T, chromosome 5 at 123,622,798 bp
  • A to G, chromosome 6 at 126,738,798 bp
  • T to C, chromosome 7 at 18,607,183 bp
  • T to A, chromosome 7 at 80,875,700 bp
  • T to C, chromosome 7 at 88,130,861 bp
  • C to G, chromosome 7 at 100,184,313 bp
  • A to T, chromosome 8 at 17,534,919 bp
  • G to T, chromosome 8 at 116,998,088 bp
  • A to T, chromosome 8 at 121,789,397 bp
  • G to A, chromosome 9 at 22,018,550 bp
  • A to C, chromosome 9 at 105,144,510 bp
  • A to G, chromosome 9 at 105,889,183 bp
  • A to C, chromosome 9 at 108,111,866 bp
  • C to A, chromosome 10 at 53,633,706 bp
  • A to T, chromosome 10 at 59,410,994 bp
  • A to G, chromosome 10 at 67,239,865 bp
  • A to G, chromosome 10 at 74,453,995 bp
  • A to G, chromosome 10 at 106,819,538 bp
  • A to G, chromosome 10 at 107,710,623 bp
  • T to C, chromosome 11 at 21,263,307 bp
  • T to C, chromosome 11 at 99,908,123 bp
  • A to T, chromosome 11 at 104,998,235 bp
  • A to C, chromosome 11 at 112,784,809 bp
  • A to G, chromosome 11 at 113,873,201 bp
  • T to C, chromosome 12 at 35,504,170 bp
  • T to A, chromosome 13 at 95,107,694 bp
  • A to G, chromosome 14 at 49,073,775 bp
  • C to T, chromosome 15 at 6,772,154 bp
  • T to C, chromosome 16 at 29,396,466 bp
  • T to A, chromosome 16 at 36,033,865 bp
  • T to C, chromosome 16 at 73,898,950 bp
  • G to A, chromosome 16 at 91,818,558 bp
  • A to C, chromosome 17 at 20,570,705 bp
  • T to C, chromosome 17 at 26,198,233 bp
  • A to T, chromosome 17 at 40,307,765 bp
  • T to C, chromosome 17 at 40,904,911 bp
  • T to C, chromosome 17 at 46,324,073 bp
  • T to C, chromosome 17 at 46,658,005 bp
  • T to C, chromosome 18 at 22,823,343 bp
  • T to C, chromosome 18 at 82,406,131 bp
  • C to T, chromosome 19 at 11,230,359 bp
  • AGACAAAGCTAAAGAGGTCTGTGTCAAATCCAGGGCTGGGGACAAAGCTAAAGAGGTCTGTGTCAAATCCAGGGCTGGGGACAAAGCTA to AGACAAAGCTAAAGAGGTCTGTGTCAAATCCAGGGCTGGGGACAAAGCTA, chromosome X at 135,745,704 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7897 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045949-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.