Strain Name:
C57BL/6J-MtgxR7909Btlr/Mmmh
Stock Number:
045958-MU
Citation ID:
RRID:MMRRC_045958-MU
Other Names:
R7909 (G1)
Major Collection:

Strain Information

Ints6
Name: integrator complex subunit 6
Synonyms: Notch2l, 2900075H24Rik, DICE1, Ddx26
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 18130
VEGA: 14
Homologene: 8121
Rbpms
Name: RNA binding protein gene with multiple splicing
Synonyms: hermes, 2700019M19Rik, 2010300K22Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 19663
Homologene: 38238
Arrdc4
Name: arrestin domain containing 4
Synonyms: 2410003C09Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 66412
Homologene: 41636
Utp20
Name: UTP20 small subunit processome component
Synonyms: mDRIM, DRIM, 3830408P06Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70683
VEGA: 10
Homologene: 38373
Dusp1
Name: dual specificity phosphatase 1
Synonyms: mkp-1, erp, 3CH134, Ptpn16, MKP1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 19252
HGNC: HGNC:3064
Homologene: 3254
Vsnl1
Name: visinin-like 1
Synonyms: VILIP
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 26950
VEGA: 12
Homologene: 2542
Gria4
Name: glutamate receptor, ionotropic, AMPA4 (alpha 4)
Synonyms: Glur-4, Glur4, spkw1, Gluralpha4
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 14802
HGNC: HGNC:4574
Homologene: 20227
Dyrk3
Name: dual-specificity tyrosine phosphorylation regulated kinase 3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226419
HGNC: HGNC:3094
Homologene: 55762
Plxdc1
Name: plexin domain containing 1
Synonyms: Tem7, 2410003I07Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 72324
Homologene: 10700
Tnks
Name: tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase
Synonyms: 4930554K12Rik, D130072O21Rik, tankyrase 1, TANK1, mTNKS1, Parp5a
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 21951
Homologene: 18405
Safb
Name: scaffold attachment factor B
Synonyms: 5330423C17Rik, SAFB1, 3110021E02Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224903
Homologene: 2229
Zfp106
Name: zinc finger protein 106
Synonyms: Cd-1, H3a, sirm, Sh3bp3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20402
Homologene: 40787
Ogdh
Name: oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide)
Synonyms: alpha-ketoglutarate dehydrogenase, 2210412K19Rik, 2210403E04Rik, d1401
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18293
HGNC: HGNC:8124
Homologene: 55662
Tasor2
Name: transcription activation suppressor family member 2
Synonyms: BC016423, Fam208b
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 105203
VEGA: 13
Homologene: 26435
Lama5
Name: laminin, alpha 5
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16776
HGNC: HGNC:6485
Homologene: 4060
Acaca
Name: acetyl-Coenzyme A carboxylase alpha
Synonyms: acetyl-CoA carboxylase, Acc1, LOC327983, Acac, A530025K05Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 107476
HGNC: HGNC:84
Homologene: 31015
Gkn2
Name: gastrokine 2
Synonyms: 1810036H07Rik, Bricd1b
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 66284
Homologene: 11942
Lyar
Name: Ly1 antibody reactive clone
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 17089
Homologene: 41200
Gcnt2
Name: glucosaminyl (N-acetyl) transferase 2 (I blood group)
Synonyms: IGnTC, IGnTB, IGnTA, 5330430K10Rik, IGnT
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 14538
VEGA: 13
HGNC: HGNC:4204
Homologene: 41535
Yme1l1
Name: YME1-like 1 (S. cerevisiae)
Synonyms: Ftsh, ATP-dependent metalloprotease FtsH1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 27377
Homologene: 31996
Hbs1l
Name: Hbs1-like (S. cerevisiae)
Synonyms: eRFS, 2810035F15Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 56422
VEGA: 10
HGNC: HGNC:4834
Homologene: 68525
Maea
Name: macrophage erythroblast attacher
Synonyms: 1110030D19Rik, Gid9
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 59003
Homologene: 4298
Psrc1
Name: proline/serine-rich coiled-coil 1
Synonyms: DDA3, 5430413I02Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 56742
Homologene: 49603
Lrch3
Name: leucine-rich repeats and calponin homology (CH) domain containing 3
Synonyms: LOC385628, 2210409B11Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 70144
Homologene: 13111
Nup153
Name: nucleoporin 153
Synonyms: B130015D15Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218210
HGNC: HGNC:8062
Homologene: 68442
Vps13a
Name: vacuolar protein sorting 13A
Synonyms: 4930516E05Rik, D330038K10Rik, 4930543C13Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 271564
VEGA: 19
HGNC: HGNC:1908
Homologene: 22068
Tctn1
Name: tectonic family member 1
Synonyms: Tect1, G730031O11Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 654470
Homologene: 49770
Septin5
Name: septin 5
Synonyms: Cdcrel1, Pnutl1, Sept5
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 18951
VEGA: 16
HGNC: HGNC:9164
Homologene: 74446
Gstm4
Name: glutathione S-transferase, mu 4
Synonyms: Gstb-4, Gstb4, 1110004G14Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 14865
HGNC: HGNC:4636
Homologene: 37357
Mttp
Name: microsomal triglyceride transfer protein
Synonyms: MTP, 1810043K16Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 17777
HGNC: HGNC:7467
Homologene: 212
Dennd4a
Name: DENN domain containing 4A
Synonyms: F730015K02Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 102442
VEGA: 9
Homologene: 55933
Sybu
Name: syntabulin (syntaxin-interacting)
Synonyms: A830027B17Rik, Golsyn/Syntabulin, 5730410E15Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 319613
VEGA: 15
Homologene: 9838
Or8b12b
Name: olfactory receptor family 8 subfamily B member 12B
Synonyms: GA_x6K02T2PVTD-31458511-31459443, MOR161-4, Olfr875
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258744
Homologene: 121527
Nqo2
Name: N-ribosyldihydronicotinamide quinone reductase 2
Synonyms: NRH: quinone oxidoreductase, Ox-2, Ox2, Nmor2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 18105
VEGA: 13
HGNC: HGNC:7856
Homologene: 696
Pnldc1
Name: poly(A)-specific ribonuclease (PARN)-like domain containing 1
Synonyms: LOC240023
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240023
VEGA: 17
Homologene: 15054
Tro
Name: trophinin
Synonyms: necdin and trophinin like, Tnn, trophinin-2, magphinin-gamma, magphinin-beta 2, magphinin-alpha, magphinin, Maged3l, Maged3, Trol
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 56191
Homologene: 75113
Ttf1
Name: transcription termination factor, RNA polymerase I
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22130
Homologene: 137223
Sycp1
Name: synaptonemal complex protein 1
Synonyms: SCP1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20957
Homologene: 2389
Slc4a11
Name: solute carrier family 4, sodium bicarbonate transporter-like, member 11
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 269356
Homologene: 12931
Trim34b
Name: tripartite motif-containing 34B
Synonyms: Trim34-2, Gm15134
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 434218
Homologene: 128238
Or2ag19
Name: olfactory receptor family 2 subfamily AG member 19
Synonyms: GA_x6K02T2PBJ9-9222217-9223176, MOR283-7, Olfr703
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258589
Tnxb
Name: tenascin XB
Synonyms: Tnx, TN-MHC
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 81877
Homologene: 49589
Zfp607a
Name: zinc finger protein 607A
Synonyms: 4732475C15Rik, Zfp607
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 545938
Homologene: 134321
Shank2
Name: SH3 and multiple ankyrin repeat domains 2
Synonyms: ProSAP1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 210274
Homologene: 105965
Tns4
Name: tensin 4
Synonyms: 9930017A07Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217169
Homologene: 13147
Rtl1
Name: retrotransposon Gaglike 1
Synonyms: Mart1, Mor1, Mar
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 353326
VEGA: 12
Homologene: 120261
Ccdc13
Name: coiled-coil domain containing 13
Synonyms: 2900041A11Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 100502861
Homologene: 87213
Slc19a1
Name: solute carrier family 19 (folate transporter), member 1
Synonyms: RFC1, RFC-1, reduced folate carrier
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 20509
Homologene: 57139
Tcaf3
Name: TRPM8 channel-associated factor 3
Synonyms: Eapa2, Fam115e
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 403088
Homologene: 74374
BC028528
Name: cDNA sequence BC028528
Synonyms: L259
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229600
Homologene: 49773
Vmn2r52
Name: vomeronasal 2, receptor 52
Synonyms: EG384534
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 384534
Homologene: 129605
Fndc7
Name: fibronectin type III domain containing 7
Synonyms: E230011A21Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 320181
Homologene: 18551
Abhd4
Name: abhydrolase domain containing 4
Synonyms: 1110035H23Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 105501
Homologene: 56937
Klhl9
Name: kelch-like 9
Synonyms: C530050O22Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242521
Homologene: 23125
Pira13
Name: paired-Ig-like receptor A13
Synonyms: ENSMUSG00000074419, Gm15448
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100041146
Homologene: 134028
Pde6b
Name: phosphodiesterase 6B, cGMP, rod receptor, beta polypeptide
Synonyms: r, Pdeb, rd, rd10, rd1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18587
HGNC: HGNC:8786
Homologene: 237
Kcnc3
Name: potassium voltage gated channel, Shaw-related subfamily, member 3
Synonyms: Kv3.3, KShIIID, Kcr2-3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16504
HGNC: HGNC:6235
Homologene: 3650
Or6c207
Name: olfactory receptor family 6 subfamily C member 207
Synonyms: GA_x6K02T2PULF-10955551-10954616, MOR114-9, Olfr777
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 258537
Homologene: 27203
Tpm2
Name: tropomyosin 2, beta
Synonyms: Trop-2, Tpm-2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 22004
Homologene: 134309
Tmem74
Name: transmembrane protein 74
Synonyms: B230382K22Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239408
VEGA: 15
Homologene: 17684
Sesn1
Name: sestrin 1
Synonyms: 1110002G11Rik, SEST1, PA26
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 140742
Homologene: 8697
Hdhd5
Name: haloacid dehalogenase like hydrolase domain containing 5
Synonyms: A930002G03Rik, Cecr5
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 214932
HGNC: HGNC:1843
Homologene: 32816
Zfp513
Name: zinc finger protein 513
Synonyms: D430028M17Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 101023
Homologene: 16955
Ceacam9
Name: CEA cell adhesion molecule 9
Synonyms: mmCGM8, Cea-5, Cea5
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 26368
Homologene: 74987
Nme6
Name: NME/NM23 nucleoside diphosphate kinase 6
Synonyms: nm23-M6, non-metastatic cells 6, protein expressed in (nucleoside-diphosphate kinase)
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 54369
Homologene: 4231
Ighv10-1
Name: immunoglobulin heavy variable 10-1
Synonyms: Gm16696
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 380808
HGNC: HGNC:5623
Tmem91
Name: transmembrane protein 91
Synonyms: A830041P22Rik, SynDIG3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 320208
Homologene: 108152
Iqank1
Name: IQ motif and ankyrin repeat containing 1
Synonyms: K230010J24Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 432964
Homologene: 141000
Gata3os
Name: GATA binding protein 3 opposite strand
Synonyms: Gm10853, 4930412O13Rik, Gata3as
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 381347
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 131,129,587 bp
  • C to A, chromosome 2 at 9,883,857 bp
  • T to A, chromosome 2 at 23,194,757 bp
  • T to A, chromosome 2 at 29,065,459 bp
  • A to G, chromosome 2 at 120,514,219 bp
  • A to G, chromosome 2 at 130,692,300 bp
  • T to A, chromosome 2 at 180,192,276 bp
  • CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT to CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT, chromosome 3 at 95,888,136 bp
  • GTGGTCACTGGTTCTGTGGTCACTGGTT to GTGGTCACTGGTTCTTTGGTCACTGGTTCTGTGGTCACTGGTT, chromosome 3 at 95,888,163 bp
  • TGGTCACTGGTTCTGTGGTCACTGGTT to TGGTCACTGGTTCTGGGGTCACTGGTTCTGTGGTCACTGGTT, chromosome 3 at 95,888,164 bp
  • CACTGGTTCTGTGGT to CACTGGTTCTGTGGTGACTGGTTCTGTGGT, chromosome 3 at 95,888,168 bp
  • TGTGGTCACTGGTT to TGTGGTCACTGGTTCCGTGGTCACTGGTT, chromosome 3 at 95,888,177 bp
  • A to T, chromosome 3 at 102,820,626 bp
  • T to A, chromosome 3 at 108,043,416 bp
  • T to C, chromosome 3 at 108,385,251 bp
  • A to T, chromosome 3 at 108,862,916 bp
  • T to A, chromosome 3 at 138,118,417 bp
  • A to T, chromosome 4 at 43,515,939 bp
  • T to C, chromosome 4 at 63,662,687 bp
  • A to T, chromosome 4 at 88,721,001 bp
  • T to C, chromosome 4 at 148,496,210 bp
  • C to T, chromosome 5 at 31,200,562 bp
  • T to G, chromosome 5 at 33,370,474 bp
  • C to T, chromosome 5 at 33,370,476 bp
  • T to A, chromosome 5 at 38,224,728 bp
  • A to T, chromosome 5 at 108,403,422 bp
  • A to G, chromosome 5 at 122,261,410 bp
  • A to G, chromosome 6 at 42,591,964 bp
  • T to A, chromosome 6 at 87,375,894 bp
  • C to A, chromosome 6 at 120,531,191 bp
  • T to C, chromosome 7 at 3,821,709 bp
  • C to A, chromosome 7 at 10,162,950 bp
  • A to G, chromosome 7 at 16,723,868 bp
  • T to C, chromosome 7 at 25,670,565 bp
  • A to T, chromosome 7 at 27,879,094 bp
  • T to A, chromosome 7 at 44,595,687 bp
  • C to T, chromosome 7 at 68,745,176 bp
  • A to G, chromosome 7 at 104,330,524 bp
  • G to A, chromosome 7 at 106,844,992 bp
  • A to T, chromosome 7 at 144,411,394 bp
  • A to G, chromosome 8 at 33,864,359 bp
  • A to T, chromosome 8 at 34,940,704 bp
  • G to T, chromosome 9 at 4,464,450 bp
  • T to C, chromosome 9 at 37,772,737 bp
  • G to T, chromosome 9 at 64,872,993 bp
  • T to A, chromosome 9 at 109,841,968 bp
  • T to A, chromosome 9 at 121,833,860 bp
  • G to A, chromosome 10 at 21,358,404 bp
  • T to C, chromosome 10 at 41,811,116 bp
  • T to A, chromosome 10 at 77,049,540 bp
  • A to T, chromosome 10 at 88,775,330 bp
  • G to T, chromosome 10 at 129,269,267 bp
  • A to G, chromosome 11 at 6,313,965 bp
  • T to A, chromosome 11 at 84,245,235 bp
  • A to T, chromosome 11 at 97,932,304 bp
  • A to G, chromosome 11 at 99,086,023 bp
  • A to T, chromosome 12 at 11,326,454 bp
  • G to A, chromosome 12 at 109,590,177 bp
  • T to A, chromosome 12 at 109,592,480 bp
  • A to T, chromosome 12 at 114,479,044 bp
  • T to C, chromosome 13 at 3,573,765 bp
  • T to A, chromosome 13 at 33,972,431 bp
  • T to A, chromosome 13 at 40,860,450 bp
  • C to T, chromosome 13 at 46,693,580 bp
  • C to T, chromosome 14 at 54,261,630 bp
  • A to T, chromosome 14 at 62,759,330 bp
  • A to T, chromosome 15 at 43,867,399 bp
  • G to T, chromosome 15 at 44,673,037 bp
  • G to T, chromosome 15 at 76,046,841 bp
  • A to G, chromosome 16 at 18,624,622 bp
  • T to A, chromosome 16 at 33,009,293 bp
  • C to A, chromosome 17 at 12,903,211 bp
  • A to T, chromosome 17 at 26,507,612 bp
  • A to G, chromosome 17 at 34,692,454 bp
  • A to G, chromosome 17 at 56,595,665 bp
  • A to G, chromosome 19 at 7,456,462 bp
  • G to A, chromosome 19 at 16,720,430 bp
  • TAAGCTGGTGCTAGTGCTGGGTGCACCACCAAAGCTAATGCTCGCTGTGCTAAAGCTGGTGCTAGTGCTGGGTGCACCACCAAAGCTAATGCT to TAAGCTGGTGCTAGTGCTGGGTGCACCACCAAAGCTAATGCT, chromosome X at 150,648,624 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7909 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045958-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.