Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7909Btlr/Mmmh
Stock Number:
045958-MU
Citation ID:
RRID:MMRRC_045958-MU
Other Names:
R7909 (G1)
Major Collection:

Strain Information

Ints6
Name: integrator complex subunit 6
Synonyms: Notch2l, 2900075H24Rik, DICE1, Ddx26
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 18130
VEGA: 14
Homologene: 8121
Rbpms
Name: RNA binding protein gene with multiple splicing
Synonyms: hermes, 2700019M19Rik, 2010300K22Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 19663
Homologene: 38238
Arrdc4
Name: arrestin domain containing 4
Synonyms: 2410003C09Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 66412
Homologene: 41636
Utp20
Name: UTP20 small subunit processome component
Synonyms: mDRIM, DRIM, 3830408P06Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70683
VEGA: 10
Homologene: 38373
Dusp1
Name: dual specificity phosphatase 1
Synonyms: mkp-1, erp, 3CH134, Ptpn16, MKP1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 19252
HGNC: HGNC:3064
Homologene: 3254
Vsnl1
Name: visinin-like 1
Synonyms: VILIP
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 26950
VEGA: 12
Homologene: 2542
Gria4
Name: glutamate receptor, ionotropic, AMPA4 (alpha 4)
Synonyms: Glur-4, Glur4, spkw1, Gluralpha4
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 14802
HGNC: HGNC:4574
Homologene: 20227
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 131,129,587 bp
  • C to A, chromosome 2 at 9,883,857 bp
  • T to A, chromosome 2 at 23,194,757 bp
  • T to A, chromosome 2 at 29,065,459 bp
  • A to G, chromosome 2 at 120,514,219 bp
  • A to G, chromosome 2 at 130,692,300 bp
  • T to A, chromosome 2 at 180,192,276 bp
  • CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT to CTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTTCTGTGGTCACTGGTT, chromosome 3 at 95,888,136 bp
  • GTGGTCACTGGTTCTGTGGTCACTGGTT to GTGGTCACTGGTTCTTTGGTCACTGGTTCTGTGGTCACTGGTT, chromosome 3 at 95,888,163 bp
  • TGGTCACTGGTTCTGTGGTCACTGGTT to TGGTCACTGGTTCTGGGGTCACTGGTTCTGTGGTCACTGGTT, chromosome 3 at 95,888,164 bp
  • CACTGGTTCTGTGGT to CACTGGTTCTGTGGTGACTGGTTCTGTGGT, chromosome 3 at 95,888,168 bp
  • TGTGGTCACTGGTT to TGTGGTCACTGGTTCCGTGGTCACTGGTT, chromosome 3 at 95,888,177 bp
  • A to T, chromosome 3 at 102,820,626 bp
  • T to A, chromosome 3 at 108,043,416 bp
  • T to C, chromosome 3 at 108,385,251 bp
  • A to T, chromosome 3 at 108,862,916 bp
  • T to A, chromosome 3 at 138,118,417 bp
  • A to T, chromosome 4 at 43,515,939 bp
  • T to C, chromosome 4 at 63,662,687 bp
  • A to T, chromosome 4 at 88,721,001 bp
  • T to C, chromosome 4 at 148,496,210 bp
  • C to T, chromosome 5 at 31,200,562 bp
  • T to G, chromosome 5 at 33,370,474 bp
  • C to T, chromosome 5 at 33,370,476 bp
  • T to A, chromosome 5 at 38,224,728 bp
  • A to T, chromosome 5 at 108,403,422 bp
  • A to G, chromosome 5 at 122,261,410 bp
  • A to G, chromosome 6 at 42,591,964 bp
  • T to A, chromosome 6 at 87,375,894 bp
  • C to A, chromosome 6 at 120,531,191 bp
  • T to C, chromosome 7 at 3,821,709 bp
  • C to A, chromosome 7 at 10,162,950 bp
  • A to G, chromosome 7 at 16,723,868 bp
  • T to C, chromosome 7 at 25,670,565 bp
  • A to T, chromosome 7 at 27,879,094 bp
  • T to A, chromosome 7 at 44,595,687 bp
  • C to T, chromosome 7 at 68,745,176 bp
  • A to G, chromosome 7 at 104,330,524 bp
  • G to A, chromosome 7 at 106,844,992 bp
  • A to T, chromosome 7 at 144,411,394 bp
  • A to G, chromosome 8 at 33,864,359 bp
  • A to T, chromosome 8 at 34,940,704 bp
  • G to T, chromosome 9 at 4,464,450 bp
  • T to C, chromosome 9 at 37,772,737 bp
  • G to T, chromosome 9 at 64,872,993 bp
  • T to A, chromosome 9 at 109,841,968 bp
  • T to A, chromosome 9 at 121,833,860 bp
  • G to A, chromosome 10 at 21,358,404 bp
  • T to C, chromosome 10 at 41,811,116 bp
  • T to A, chromosome 10 at 77,049,540 bp
  • A to T, chromosome 10 at 88,775,330 bp
  • G to T, chromosome 10 at 129,269,267 bp
  • A to G, chromosome 11 at 6,313,965 bp
  • T to A, chromosome 11 at 84,245,235 bp
  • A to T, chromosome 11 at 97,932,304 bp
  • A to G, chromosome 11 at 99,086,023 bp
  • A to T, chromosome 12 at 11,326,454 bp
  • G to A, chromosome 12 at 109,590,177 bp
  • T to A, chromosome 12 at 109,592,480 bp
  • A to T, chromosome 12 at 114,479,044 bp
  • T to C, chromosome 13 at 3,573,765 bp
  • T to A, chromosome 13 at 33,972,431 bp
  • T to A, chromosome 13 at 40,860,450 bp
  • C to T, chromosome 13 at 46,693,580 bp
  • C to T, chromosome 14 at 54,261,630 bp
  • A to T, chromosome 14 at 62,759,330 bp
  • A to T, chromosome 15 at 43,867,399 bp
  • G to T, chromosome 15 at 44,673,037 bp
  • G to T, chromosome 15 at 76,046,841 bp
  • A to G, chromosome 16 at 18,624,622 bp
  • T to A, chromosome 16 at 33,009,293 bp
  • C to A, chromosome 17 at 12,903,211 bp
  • A to T, chromosome 17 at 26,507,612 bp
  • A to G, chromosome 17 at 34,692,454 bp
  • A to G, chromosome 17 at 56,595,665 bp
  • A to G, chromosome 19 at 7,456,462 bp
  • G to A, chromosome 19 at 16,720,430 bp
  • TAAGCTGGTGCTAGTGCTGGGTGCACCACCAAAGCTAATGCTCGCTGTGCTAAAGCTGGTGCTAGTGCTGGGTGCACCACCAAAGCTAATGCT to TAAGCTGGTGCTAGTGCTGGGTGCACCACCAAAGCTAATGCT, chromosome X at 150,648,624 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7909 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045958-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.