Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7913Btlr/Mmmh
Stock Number:
045961-MU
Citation ID:
RRID:MMRRC_045961-MU
Other Names:
R7913 (G1)
Major Collection:

Strain Information

Atrn
Name: attractin
Synonyms: Mgca
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11990
HGNC: HGNC:885
Homologene: 22542
Tead4
Name: TEA domain family member 4
Synonyms: Tefr1a, TEAD-4, Tcf13r1, TEF-3, ETFR-2a, Etfr2, Tefr, Tef3, Rtef1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 21679
Homologene: 74463
Odf2l
Name: outer dense fiber of sperm tails 2-like
Synonyms: 4733401D09Rik, 9630045K08Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 52184
Homologene: 12011
Cs
Name: citrate synthase
Synonyms: Cis, 2610511A05Rik, 9030605P22Rik, ahl4
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 12974
VEGA: 10
HGNC: HGNC:2422
Homologene: 56073
Setd3
Name: SET domain containing 3
Synonyms: 2610305M23Rik, D12Ertd771e, 2610102I01Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 52690
Homologene: 41748
Hspa4
Name: heat shock protein 4
Synonyms: APG-2, Hsp70RY, Hsp110, 70kDa
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 15525
HGNC: HGNC:5237
Homologene: 1624
Rab3gap2
Name: RAB3 GTPase activating protein subunit 2
Synonyms: 1110059F07Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98732
Homologene: 40842
Ralgapb
Name: Ral GTPase activating protein, beta subunit (non-catalytic)
Synonyms: B230339M05Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228850
Homologene: 10666
Ufd1
Name: ubiquitin recognition factor in ER-associated degradation 1
Synonyms: Ufd1, Ufd1l
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 22230
Homologene: 39090
Cep78
Name: centrosomal protein 78
Synonyms: 5730599I05Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 208518
VEGA: 19
Homologene: 11030
Dync1h1
Name: dynein cytoplasmic 1 heavy chain 1
Synonyms: MAP1C, dynein heavy chain, retrograde transport, Dnec1, Loa, 9930018I23Rik, Dnchc1, Swl
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 13424
HGNC: HGNC:2961
Homologene: 1053
Apaf1
Name: apoptotic peptidase activating factor 1
Synonyms: Apaf1l, 6230400I06Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 11783
HGNC: HGNC:576
Homologene: 7626
Ncapd3
Name: non-SMC condensin II complex, subunit D3
Synonyms: 4632407J06Rik, 2810487N22Rik, B130055D15Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 78658
VEGA: 9
Homologene: 41021
Peg3
Name: paternally expressed 3
Synonyms: Pw1, Zfp102, End4, Gcap4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18616
HGNC: HGNC:8826
Homologene: 31363
Dpy19l4
Name: dpy-19 like 4
Synonyms: LOC381510, Narg3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 381510
Homologene: 18773
Zbtb44
Name: zinc finger and BTB domain containing 44
Synonyms: 6030404E16Rik, Btbd15
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235132
VEGA: 9
Homologene: 18221
Fgd2
Name: FYVE, RhoGEF and PH domain containing 2
Synonyms: tcs-2, Tcd-2, tcs2, Tcd2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 26382
HGNC: HGNC:3664
Homologene: 8438
Col24a1
Name: collagen, type XXIV, alpha 1
Synonyms: 5430404K19Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 71355
Homologene: 65061
Nell1
Name: NEL-like 1
Synonyms: B230343H07Rik, l7R6
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 338352
HGNC: HGNC:7750
Homologene: 4486
Dchs1
Name: dachsous cadherin related 1
Synonyms: C130033F22Rik, 3110041P15Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233651
Homologene: 2771
Nlrp1b
Name: NLR family, pyrin domain containing 1B
Synonyms: Nalp1b
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 637515
Homologene: 19080
Miox
Name: myo-inositol oxygenase
Synonyms: RSOR, 0610009I10Rik, C85427, Aldrl6
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 56727
Homologene: 9732
Slc35e1
Name: solute carrier family 35, member E1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 270066
Homologene: 49075
Or10al2
Name: olfactory receptor family 10 subfamily AL member 2
Synonyms: GA_x6K02T2PSCP-2131124-2132089, MOR263-13, Olfr118
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 404308
Homologene: 110622
Nlrp9b
Name: NLR family, pyrin domain containing 9B
Synonyms: Nalp9b, Nalp-delta
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243874
Homologene: 18530
Or5b120
Name: olfactory receptor family 5 subfamily B member 120
Synonyms: GA_x6K02T2RE5P-3834960-3835907, MOR202-10, Olfr1477
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258691
Homologene: 110492
Or5ac23
Name: olfactory receptor family 5 subfamily AC member 23
Synonyms: GA_x54KRFPKG5P-55543875-55542958, MOR182-11P, Olfr205
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 257881
Homologene: 79469
Hivep1
Name: human immunodeficiency virus type I enhancer binding protein 1
Synonyms: Cryabp1, alphaA-CRYBP1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 110521
VEGA: 13
HGNC: HGNC:4920
Homologene: 1596
Dlg5
Name: discs large MAGUK scaffold protein 5
Synonyms: 4933429D20Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 71228
HGNC: HGNC:2904
Homologene: 3486
Wt1
Name: WT1 transcription factor
Synonyms: Wt-1, D630046I19Rik, Wilms tumor 1 homolog
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22431
Homologene: 11536
Synj1
Name: synaptojanin 1
Synonyms: A930006D20Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 104015
Homologene: 48252
Vmn2r52
Name: vomeronasal 2, receptor 52
Synonyms: EG384534
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 384534
Homologene: 129605
H2-M1
Name: histocompatibility 2, M region locus 1
Synonyms: H-2M1, Mb1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224756
Homologene: 110792
Sec16b
Name: SEC16 homolog B, endoplasmic reticulum export factor
Synonyms: Rgpr-p117, Rgpr, Lztr2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 89867
Homologene: 13227
Or1e22
Name: olfactory receptor family 1 subfamily E member 22
Synonyms: GA_x6K02T2P1NL-3646409-3645474, MOR135-4, Olfr381
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 259024
Hsd17b6
Name: hydroxysteroid (17-beta) dehydrogenase 6
Synonyms: Rdh8, 17betaHSD9, Hsd17b9
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 27400
VEGA: 10
Homologene: 20811
Mettl9
Name: methyltransferase like 9
Synonyms: Drev, 0610012D09Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 59052
Homologene: 41092
Or5m10
Name: olfactory receptor family 5 subfamily M member 10
Synonyms: GA_x6K02T2Q125-47363965-47364900, MOR196-3, Olfr1023
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258580
Homologene: 128087
Prl3c1
Name: prolactin family 3, subfamily c, member 1
Synonyms: PLP-J, PLP I, Prlpj
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 27372
Homologene: 49353
Pik3c2b
Name: phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta
Synonyms: PI3K-C2beta, C330011J12Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240752
HGNC: HGNC:8972
Homologene: 20582
Vmn2r67
Name: vomeronasal 2, receptor 67
Synonyms: EG620672
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 620672
Homologene: 115466
Card10
Name: caspase recruitment domain family, member 10
Synonyms: CARMA3, Bimp1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 105844
Homologene: 8728
Grid1
Name: glutamate receptor, ionotropic, delta 1
Synonyms: GluRdelta1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 14803
HGNC: HGNC:4575
Homologene: 69017
Ugt1a10
Name: UDP glycosyltransferase 1 family, polypeptide A10
Synonyms: A13
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 394430
Homologene: 133281
Fmo4
Name: flavin containing monooxygenase 4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226564
HGNC: HGNC:3772
Homologene: 68219
Nyap1
Name: neuronal tyrosine-phosphorylated phosphoinositide 3-kinase adaptor 1
Synonyms: Nyap1, 6430598A04Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 243300
Homologene: 18320
R3hdm4
Name: R3H domain containing 4
Synonyms: C030046I01Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 109284
VEGA: 10
Homologene: 16343
Syt1
Name: synaptotagmin I
Synonyms: G630098F17Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 20979
Homologene: 4122
Ncs1
Name: neuronal calcium sensor 1
Synonyms: NCS-1, 9430075O15Rik, A730032G13Rik, Freq
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14299
HGNC: HGNC:3953
Homologene: 5719
Tescl
Name: tescalcin-like
Synonyms: 1700008P20Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 69301
Homologene: 129777
Nudt16l1
Name: nudix hydrolase 16 like 1
Synonyms: 5330437I08Rik, 1110001K21Rik, nudix (nucleoside diphosphate linked moiety X)-type motif 16-like 1, syndesmos
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 66911
VEGA: 16
Homologene: 12053
Taar7e
Name: trace amine-associated receptor 7E
Synonyms: LOC276742
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 276742
Homologene: 134040
Or12e14
Name: olfactory receptor family 12 subfamily E member 14
Synonyms: GA_x6K02T2Q125-49347783-49348734, MOR264-11, Olfr1150
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258104
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 88,055,755 bp
  • T to C, chromosome 1 at 133,090,061 bp
  • T to C, chromosome 1 at 157,529,329 bp
  • T to C, chromosome 1 at 162,794,172 bp
  • T to C, chromosome 1 at 173,926,957 bp
  • T to C, chromosome 1 at 185,262,816 bp
  • C to A, chromosome 2 at 31,287,284 bp
  • T to A, chromosome 2 at 85,887,730 bp
  • A to G, chromosome 2 at 87,846,693 bp
  • T to G, chromosome 2 at 105,166,860 bp
  • G to A, chromosome 2 at 130,970,211 bp
  • A to T, chromosome 2 at 158,465,939 bp
  • C to T, chromosome 3 at 145,153,483 bp
  • G to T, chromosome 3 at 145,431,866 bp
  • A to T, chromosome 4 at 11,265,859 bp
  • T to A, chromosome 4 at 143,615,045 bp
  • A to G, chromosome 5 at 137,734,969 bp
  • A to G, chromosome 6 at 128,243,368 bp
  • GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC to GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC, chromosome 7 at 6,709,168 bp
  • C to A, chromosome 7 at 10,162,950 bp
  • A to T, chromosome 7 at 20,045,800 bp
  • C to A, chromosome 7 at 24,333,651 bp
  • A to T, chromosome 7 at 30,178,223 bp
  • T to A, chromosome 7 at 50,279,522 bp
  • G to A, chromosome 7 at 85,151,828 bp
  • T to C, chromosome 7 at 105,759,228 bp
  • T to A, chromosome 7 at 121,076,301 bp
  • T to A, chromosome 7 at 123,464,272 bp
  • T to C, chromosome 8 at 72,484,662 bp
  • T to A, chromosome 9 at 27,048,226 bp
  • C to T, chromosome 9 at 31,054,208 bp
  • T to A, chromosome 10 at 24,038,004 bp
  • C to T, chromosome 10 at 79,911,945 bp
  • A to G, chromosome 10 at 91,060,271 bp
  • T to C, chromosome 10 at 108,642,248 bp
  • T to C, chromosome 10 at 127,997,776 bp
  • A to T, chromosome 10 at 128,350,441 bp
  • A to C, chromosome 11 at 53,262,307 bp
  • C to A, chromosome 11 at 71,217,711 bp
  • A to G, chromosome 11 at 73,486,398 bp
  • A to T, chromosome 12 at 108,107,665 bp
  • A to T, chromosome 12 at 110,628,734 bp
  • A to G, chromosome 13 at 27,199,410 bp
  • T to A, chromosome 13 at 42,156,366 bp
  • A to T, chromosome 14 at 24,137,124 bp
  • T to A, chromosome 14 at 35,569,697 bp
  • A to T, chromosome 15 at 78,781,103 bp
  • A to G, chromosome 15 at 89,336,582 bp
  • C to A, chromosome 16 at 4,939,381 bp
  • G to T, chromosome 16 at 18,814,866 bp
  • C to T, chromosome 16 at 59,329,243 bp
  • A to T, chromosome 16 at 90,991,427 bp
  • G to T, chromosome 17 at 29,374,045 bp
  • T to C, chromosome 17 at 36,670,237 bp
  • A to T, chromosome 17 at 37,672,108 bp
  • T to A, chromosome 19 at 13,503,207 bp
  • T to C, chromosome 19 at 15,970,577 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7913 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045961-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.