Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7917Btlr/Mmmh
Stock Number:
045965-MU
Citation ID:
RRID:MMRRC_045965-MU
Other Names:
R7917 (G1)
Major Collection:

Strain Information

Hapln1
Name: hyaluronan and proteoglycan link protein 1
Synonyms: link protein, cartilage linking protein 1, Crtl1l, Crtl1, CLP, LP-1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 12950
VEGA: 13
HGNC: HGNC:2380
Homologene: 1420
Nrcam
Name: neuronal cell adhesion molecule
Synonyms: Bravo, C030017F07Rik, C130076O07Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 319504
VEGA: 12
HGNC: HGNC:7994
Homologene: 21041
Cfdp1
Name: craniofacial development protein 1
Synonyms: cp27, Bucentaur, Bcnt
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 23837
HGNC: HGNC:1873
Homologene: 4611
Pcif1
Name: phosphorylated CTD interacting factor 1
Synonyms: 2310022K11Rik, F730014I05Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228866
Homologene: 11134
Fryl
Name: FRY like transcription coactivator
Synonyms: 2310004H21Rik, 2510002A14Rik, 9030227G01Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 72313
Homologene: 103956
Terf1
Name: telomeric repeat binding factor 1
Synonyms: Trf1, Trbf1, Pin2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 21749
Homologene: 7570
Thrap3
Name: thyroid hormone receptor associated protein 3
Synonyms: 9330151F09Rik, Trap150, B230333E16Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230753
Homologene: 31289
Fermt2
Name: fermitin family member 2
Synonyms: Mig2, Kindlin-2, Plekhc1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 218952
Homologene: 4976
Mtg1
Name: mitochondrial ribosome-associated GTPase 1
Synonyms: LOC212508, Gtpbp7
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 212508
Homologene: 44527
Dsp
Name: desmoplakin
Synonyms: 2300002E22Rik, DP, 5730453H04Rik, rul
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 109620
HGNC: HGNC:3052
Homologene: 37922
Cyb5r1
Name: cytochrome b5 reductase 1
Synonyms: B5R.1, 1500005G05Rik, Nqo3a2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 72017
Homologene: 96059
Zfp266
Name: zinc finger protein 266
Synonyms: 5330440G10Rik, 5730601F06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 77519
Homologene: 105676
Rag2
Name: recombination activating gene 2
Synonyms: Rag-2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19374
HGNC: HGNC:9832
Homologene: 7507
Tek
Name: TEK receptor tyrosine kinase
Synonyms: Hyk, Tie2, Cd202b, tie-2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 21687
Homologene: 397
Scnn1g
Name: sodium channel, nonvoltage-gated 1 gamma
Synonyms: ENaC gamma
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20278
Homologene: 20280
Adam20
Name: a disintegrin and metallopeptidase domain 20
Synonyms: 4930529F22Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 384806
HGNC: HGNC:199
Homologene: 128364
Exosc9
Name: exosome component 9
Synonyms: PM/Scl-75, RRP45, p6, p5, Pmscl1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 50911
HGNC: HGNC:9137
Homologene: 3693
Polq
Name: polymerase (DNA directed), theta
Synonyms: A430110D14Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 77782
HGNC: HGNC:9186
Homologene: 32727
Pdzd8
Name: PDZ domain containing 8
Synonyms: A630041P07Rik, Pdzk8
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 107368
VEGA: 19
Homologene: 14879
Abca8a
Name: ATP-binding cassette, sub-family A member 8a
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217258
HGNC: HGNC:38
Homologene: 131160
Pcdha1
Name: protocadherin alpha 1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 116731
HGNC: HGNC:8663
Homologene: 75093
Zxdc
Name: ZXD family zinc finger C
Synonyms: B930086F11Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 80292
Homologene: 82340
Or4f57
Name: olfactory receptor family 4 subfamily F member 57
Synonyms: GA_x6K02T2Q125-73008844-73007882, MOR245-22, Olfr1308
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258258
Homologene: 45797
Igfn1
Name: immunoglobulin-like and fibronectin type III domain containing 1
Synonyms: 9830123M21Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226438
Homologene: 130054
Il3ra
Name: interleukin 3 receptor, alpha chain
Synonyms: IL-3 receptor alpha chain, CD123, SUT-1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 16188
VEGA: 14
HGNC: HGNC:6012
Homologene: 48088
Fscn2
Name: fascin actin-bundling protein 2
Synonyms: C630046B20Rik, ahl8
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 238021
HGNC: HGNC:3960
Homologene: 22722
Hdac9
Name: histone deacetylase 9
Synonyms: HDRP, Hdac7b, Mitr, D030072B18Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 79221
Homologene: 128578
Or13g1
Name: olfactory receptor family 13 subfamily G member 1
Synonyms: GA_x6K02T2NHDJ-9801340-9802266, MOR251-4P, Olfr309
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258196
Homologene: 47595
Brinp1
Name: bone morphogenic protein/retinoic acid inducible neural specific 1
Synonyms: Dbccr1, Fam5a, Dbc1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56710
HGNC: HGNC:2687
Homologene: 8754
Zeb2
Name: zinc finger E-box binding homeobox 2
Synonyms: SIP1, Zfx1b, 9130203F04Rik, D130016B08Rik, Zfhx1b
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 24136
Homologene: 8868
Kti12
Name: KTI12 homolog, chromatin associated
Synonyms: 1110001A12Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100087
Homologene: 6347
Uba1y
Name: ubiquitin-activating enzyme, Chr Y
Synonyms: Sby, Ube-2, A1s9Y-1, Ube1y-1, Ube1y1
Type: Gene
Species: Mouse
Chromosome: Y
NCBI: 22202
Homologene: 129435
Pcna
Name: proliferating cell nuclear antigen
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18538
HGNC: HGNC:8729
Homologene: 1945
Sri
Name: sorcin
Synonyms: Sor, 2210417O06Rik, 2900070H08Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 109552
Homologene: 37736
Or8b1
Name: olfactory receptor family 8 subfamily B member 1
Synonyms: GA_x6K02T2PVTD-32194085-32195020, MOR167-2, Olfr906
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258799
VEGA: 9
Homologene: 132439
Vmn2r29
Name: vomeronasal 2, receptor 29
Synonyms: 6430701C03Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 76229
Homologene: 113703
Pcdhga8
Name: protocadherin gamma subfamily A, 8
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93716
HGNC: HGNC:8706
Homologene: 57162
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 15,819,076 bp
  • T to A, chromosome 1 at 134,406,900 bp
  • T to C, chromosome 1 at 135,971,968 bp
  • T to C, chromosome 2 at 44,996,409 bp
  • A to T, chromosome 2 at 101,629,695 bp
  • A to C, chromosome 2 at 111,960,965 bp
  • A to T, chromosome 2 at 132,253,009 bp
  • G to T, chromosome 2 at 164,888,472 bp
  • G to A, chromosome 3 at 36,553,819 bp
  • T to A, chromosome 4 at 21,748,158 bp
  • A to G, chromosome 4 at 68,904,953 bp
  • T to C, chromosome 4 at 94,820,135 bp
  • A to C, chromosome 4 at 108,848,246 bp
  • G to T, chromosome 4 at 108,848,247 bp
  • G to A, chromosome 4 at 126,175,420 bp
  • T to C, chromosome 5 at 8,063,409 bp
  • A to G, chromosome 5 at 73,054,532 bp
  • T to A, chromosome 6 at 90,382,009 bp
  • A to G, chromosome 7 at 7,231,728 bp
  • T to C, chromosome 7 at 86,306,478 bp
  • T to C, chromosome 7 at 121,743,693 bp
  • A to T, chromosome 7 at 140,147,265 bp
  • A to G, chromosome 8 at 40,796,371 bp
  • GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA to GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA, chromosome 8 at 109,624,195 bp
  • C to A, chromosome 8 at 111,840,401 bp
  • T to C, chromosome 9 at 20,505,127 bp
  • T to A, chromosome 9 at 38,488,609 bp
  • G to T, chromosome 11 at 110,068,107 bp
  • G to A, chromosome 11 at 120,367,256 bp
  • T to A, chromosome 12 at 34,433,210 bp
  • T to G, chromosome 12 at 44,573,763 bp
  • A to T, chromosome 12 at 114,487,545 bp
  • C to T, chromosome 13 at 38,167,639 bp
  • T to C, chromosome 13 at 89,607,878 bp
  • T to A, chromosome 14 at 14,350,773 bp
  • C to G, chromosome 14 at 45,461,861 bp
  • T to A, chromosome 16 at 37,065,288 bp
  • T to A, chromosome 18 at 36,932,201 bp
  • T to A, chromosome 18 at 37,727,616 bp
  • A to G, chromosome 19 at 59,345,086 bp
  • A to G, chromosome Y at 821,274 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7917 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045965-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.