Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7925Btlr/Mmmh
Stock Number:
045972-MU
Citation ID:
RRID:MMRRC_045972-MU
Other Names:
R7925 (G1)
Major Collection:

Strain Information

Prrc2b
Name: proline-rich coiled-coil 2B
Synonyms: 5830434P21Rik, Bat2l
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227723
Homologene: 106649
Kdm4c
Name: lysine (K)-specific demethylase 4C
Synonyms: 2410141F18Rik, Jmjd2c
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 76804
Homologene: 41004
Snx10
Name: sorting nexin 10
Synonyms: 2410004M09Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 71982
Homologene: 32171
Ube3c
Name: ubiquitin protein ligase E3C
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100763
Homologene: 8783
Sf3a2
Name: splicing factor 3a, subunit 2
Synonyms: SFA66, PRP11, Sap62, 66kDa
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 20222
Homologene: 133823
Atp2c1
Name: ATPase, Ca++-sequestering
Synonyms: SPCA, ATP2C1A, PMR1, 1700121J11Rik, D930003G21Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235574
Homologene: 56672
Brca1
Name: breast cancer 1, early onset
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12189
HGNC: HGNC:1100
Homologene: 5276
Wwc1
Name: WW, C2 and coiled-coil domain containing 1
Synonyms: Kibra
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 211652
Homologene: 69180
Lrrc28
Name: leucine rich repeat containing 28
Synonyms: 2310058O11Rik, 2210012C09Rik, 1300004K21Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 67867
Homologene: 16944
Tsc22d4
Name: Tsc22 domain family, member 4
Synonyms: Thg-1pit, 0610009M14Rik, 1700023B23Rik, Tsc22d4, Spacdr
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 78829
Homologene: 11390
Svil
Name: supervillin
Synonyms: B430302E16Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225115
Homologene: 25090
Pdgfra
Name: platelet derived growth factor receptor, alpha polypeptide
Synonyms: CD140a, Pdgfr-2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18595
HGNC: HGNC:8803
Homologene: 31361
Nlrp4a
Name: NLR family, pyrin domain containing 4A
Synonyms: Nalp-eta, E330028A19Rik, Nalp4a
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243880
Homologene: 79696
Fat3
Name: FAT atypical cadherin 3
Synonyms: LOC234973, LOC382129, D430038H04Rik, 9430076A06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 270120
VEGA: 9
Homologene: 82252
F5
Name: coagulation factor V
Synonyms: Cf-5, Cf5
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14067
HGNC: HGNC:3542
Homologene: 104
Colec10
Name: collectin sub-family member 10
Synonyms: CL-L1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239447
VEGA: 15
HGNC: HGNC:2220
Homologene: 31381
Mgam
Name: maltase-glucoamylase
Synonyms: 6030407P20Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232714
HGNC: HGNC:7043
Homologene: 130099
Fhad1
Name: forkhead-associated phosphopeptide binding domain 1
Synonyms: 2900090M10Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 329977
Homologene: 77947
Grm3
Name: glutamate receptor, metabotropic 3
Synonyms: mGluR3, 0710001G23Rik, Gprc1c, mGlu3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 108069
HGNC: HGNC:4595
Homologene: 651
Obscn
Name: obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF
Synonyms: LOC380698, OTTMUSG00000005786
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380698
Homologene: 70869
Fras1
Name: Fraser extracellular matrix complex subunit 1
Synonyms: bl, E130113P14Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231470
Homologene: 23516
Rskr
Name: ribosomal protein S6 kinase related
Synonyms: BC030499
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216976
Homologene: 79669
Cldn22
Name: claudin 22
Synonyms: 2210404A22Rik, 5330431C14Rik, 9530051B05Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 75677
HGNC: HGNC:2044
Homologene: 129823
4933427D14Rik
Name: RIKEN cDNA 4933427D14 gene
Synonyms: Gm43951
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74477
Homologene: 8874
Cpn2
Name: carboxypeptidase N, polypeptide 2
Synonyms: 1300018K11Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 71756
VEGA: 16
HGNC: HGNC:2313
Homologene: 19487
Lrrc66
Name: leucine rich repeat containing 66
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231296
Homologene: 51944
Itgbl1
Name: integrin, beta-like 1
Synonyms: with EGF-like repeat domains, B930011D01Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 223272
HGNC: HGNC:6164
Homologene: 3519
Cdh20
Name: cadherin 20
Synonyms: Cdh7
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 23836
HGNC: HGNC:1760
Homologene: 8015
Asb15
Name: ankyrin repeat and SOCS box-containing 15
Synonyms: 4930400E23Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 78910
Homologene: 43797
Abcc2
Name: ATP-binding cassette, sub-family C member 2
Synonyms: multidrug resistance protein 2, Mrp2, Cmoat
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 12780
HGNC: HGNC:53
Homologene: 68052
Kcnt2
Name: potassium channel, subfamily T, member 2
Synonyms: E330038N15Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240776
Homologene: 16121
Serpinb8
Name: serine (or cysteine) peptidase inhibitor, clade B, member 8
Synonyms: ovalbumin, CAP-2, CAP2, Spi8, NK10
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 20725
HGNC: HGNC:8952
Homologene: 74445
Or9g4
Name: olfactory receptor family 9 subfamily G member 4
Synonyms: GA_x6K02T2Q125-47154544-47153606, MOR213-4, Olfr1006
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258563
Homologene: 17295
Rbm20
Name: RNA binding motif protein 20
Synonyms: 2010003H22Rik, 1110018J23Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 73713
Homologene: 28386
Ccn5
Name: cellular communication network factor 5
Synonyms: rCop1, Crgr4, CCN5, Wisp2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22403
Homologene: 2882
Sh2b2
Name: SH2B adaptor protein 2
Synonyms: Aps
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 23921
Homologene: 10309
Musk
Name: muscle, skeletal, receptor tyrosine kinase
Synonyms: MDK4, Nsk1, Nsk2, Nsk3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18198
HGNC: HGNC:7525
Homologene: 4084
Lrrc45
Name: leucine rich repeat containing 45
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217366
Homologene: 17019
Slc6a17
Name: solute carrier family 6 (neurotransmitter transporter), member 17
Synonyms: D130012J15Rik, NTT4
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229706
Homologene: 27775
Or1l8
Name: olfactory receptor family 1 subfamily L member 8
Synonyms: GA_x6K02T2NLDC-33622642-33621710, MOR138-2, Olfr355
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258618
Homologene: 132326
4930433I11Rik
Name: RIKEN cDNA 4930433I11 gene
Synonyms: LOC243944
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243944
Homologene: 77912
Kti12
Name: KTI12 homolog, chromatin associated
Synonyms: 1110001A12Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100087
Homologene: 6347
A930002H24Rik
Name: RIKEN cDNA A930002H24 gene
Type: Gene
Species: Mouse
Chromosome: 17
Ahr
Name: aryl-hydrocarbon receptor
Synonyms: dioxin receptor, Ahh, Ah, In, Ahre, bHLHe76
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 11622
HGNC: HGNC:348
Homologene: 1224
Msrb2
Name: methionine sulfoxide reductase B2
Synonyms: 2310050L06Rik, Msrb
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 76467
Homologene: 56555
Ly6g6e
Name: lymphocyte antigen 6 family member G6E
Synonyms: 2310011I02Rik, G6e
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 70274
Homologene: 41553
Opalin
Name: oligodendrocytic myelin paranodal and inner loop protein
Synonyms: Tmp10, Tmem10
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226115
VEGA: 19
Homologene: 13237
Coasy
Name: Coenzyme A synthase
Synonyms: Ukr1, 1300003G02Rik, Dpck, Ppat
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 71743
Homologene: 11889
Stard10
Name: StAR related lipid transfer domain containing 10
Synonyms: TISP-81, PC-TP2, Pctpl, PCTP2, NY-C0-28, CGI-52, Sdccag28
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 56018
Homologene: 4841
Pgam2
Name: phosphoglycerate mutase 2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 56012
HGNC: HGNC:8889
Homologene: 56228
Asphd1
Name: aspartate beta-hydroxylase domain containing 1
Synonyms: A830007L07Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233879
Fbxl16
Name: F-box and leucine-rich repeat protein 16
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 214931
VEGA: 17
Homologene: 17732
Chst11
Name: carbohydrate sulfotransferase 11
Synonyms: C4ST-1, C4ST1, C4ST, chondroitin 4, 1110020P09Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 58250
Homologene: 56808
Smim10l1
Name: small integral membrane protein 10 like 1
Synonyms: 2700089E24Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 381820
Homologene: 130035
Pgls
Name: 6-phosphogluconolactonase
Synonyms: 1110030K05Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 66171
HGNC: HGNC:8903
Homologene: 6037
Or1e28
Name: olfactory receptor family 1 subfamily E member 28
Synonyms: GA_x6K02T2P1NL-3884648-3883708, MOR135-22, Or1e28-ps1, Olfr388-ps1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258182
Or4f4-ps1
Name: olfactory receptor family 4 subfamily F member 4, pseudogene 1
Synonyms: GA_x6K02T2Q125-72550790-72551728, MOR245-32_p, OTTMUSG00000015084, Olfr1291, Olfr1291-ps1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 257819
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 104,984,748 bp
  • T to C, chromosome 1 at 107,598,985 bp
  • T to A, chromosome 1 at 140,354,509 bp
  • T to A, chromosome 1 at 164,176,366 bp
  • A to T, chromosome 2 at 19,383,280 bp
  • A to G, chromosome 2 at 32,204,115 bp
  • A to G, chromosome 2 at 36,927,359 bp
  • T to C, chromosome 2 at 85,674,563 bp
  • A to G, chromosome 2 at 111,499,821 bp
  • G to C, chromosome 2 at 163,829,041 bp
  • T to C, chromosome 3 at 107,495,740 bp
  • T to A, chromosome 4 at 58,367,513 bp
  • T to C, chromosome 4 at 74,404,821 bp
  • A to C, chromosome 4 at 108,848,246 bp
  • G to T, chromosome 4 at 108,848,247 bp
  • A to G, chromosome 4 at 141,954,187 bp
  • T to A, chromosome 5 at 9,589,880 bp
  • T to A, chromosome 5 at 29,646,431 bp
  • A to T, chromosome 5 at 73,608,492 bp
  • T to A, chromosome 5 at 75,192,418 bp
  • A to G, chromosome 5 at 96,781,584 bp
  • A to T, chromosome 5 at 136,224,261 bp
  • A to G, chromosome 5 at 137,751,365 bp
  • T to A, chromosome 6 at 24,562,724 bp
  • C to T, chromosome 6 at 40,759,051 bp
  • T to C, chromosome 6 at 51,580,321 bp
  • G to A, chromosome 6 at 133,105,582 bp
  • C to A, chromosome 7 at 26,450,586 bp
  • C to T, chromosome 7 at 40,994,082 bp
  • T to C, chromosome 7 at 67,619,109 bp
  • T to C, chromosome 7 at 101,342,631 bp
  • T to A, chromosome 7 at 126,948,456 bp
  • T to C, chromosome 8 at 47,825,187 bp
  • T to C, chromosome 8 at 71,592,352 bp
  • C to T, chromosome 9 at 16,031,360 bp
  • A to G, chromosome 9 at 105,442,770 bp
  • T to C, chromosome 9 at 110,841,035 bp
  • ACTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGT to ACTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGT, chromosome 10 at 80,804,437 bp
  • T to A, chromosome 10 at 83,190,954 bp
  • T to A, chromosome 11 at 5,803,007 bp
  • T to C, chromosome 11 at 35,844,163 bp
  • C to G, chromosome 11 at 59,112,555 bp
  • A to C, chromosome 11 at 72,180,501 bp
  • A to G, chromosome 11 at 73,724,536 bp
  • T to C, chromosome 11 at 78,291,623 bp
  • T to G, chromosome 11 at 101,083,696 bp
  • A to G, chromosome 11 at 101,508,146 bp
  • T to A, chromosome 11 at 120,715,880 bp
  • G to A, chromosome 12 at 35,515,068 bp
  • A to G, chromosome 14 at 43,261,566 bp
  • G to A, chromosome 14 at 123,973,323 bp
  • T to C, chromosome 15 at 54,462,371 bp
  • G to T, chromosome 16 at 30,260,801 bp
  • T to G, chromosome 16 at 88,506,645 bp
  • A to G, chromosome 17 at 25,816,906 bp
  • A to T, chromosome 17 at 35,077,918 bp
  • A to T, chromosome 17 at 63,863,397 bp
  • C to A, chromosome 18 at 5,118,357 bp
  • T to A, chromosome 19 at 41,063,803 bp
  • A to G, chromosome 19 at 43,807,112 bp
  • T to A, chromosome 19 at 53,813,322 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7925 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045972-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.