Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7925Btlr/Mmmh
Stock Number:
045972-MU
Citation ID:
RRID:MMRRC_045972-MU
Other Names:
R7925 (G1)
Major Collection:

Strain Information

Prrc2b
Name: proline-rich coiled-coil 2B
Synonyms: 5830434P21Rik, Bat2l
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227723
Homologene: 106649
Kdm4c
Name: lysine (K)-specific demethylase 4C
Synonyms: 2410141F18Rik, Jmjd2c
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 76804
Homologene: 41004
Snx10
Name: sorting nexin 10
Synonyms: 2410004M09Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 71982
Homologene: 32171
Ube3c
Name: ubiquitin protein ligase E3C
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100763
Homologene: 8783
Sf3a2
Name: splicing factor 3a, subunit 2
Synonyms: SFA66, PRP11, Sap62, 66kDa
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 20222
Homologene: 133823
Atp2c1
Name: ATPase, Ca++-sequestering
Synonyms: SPCA, ATP2C1A, PMR1, 1700121J11Rik, D930003G21Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235574
Homologene: 56672
Brca1
Name: breast cancer 1, early onset
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12189
HGNC: HGNC:1100
Homologene: 5276
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 104,984,748 bp
  • T to C, chromosome 1 at 107,598,985 bp
  • T to A, chromosome 1 at 140,354,509 bp
  • T to A, chromosome 1 at 164,176,366 bp
  • A to T, chromosome 2 at 19,383,280 bp
  • A to G, chromosome 2 at 32,204,115 bp
  • A to G, chromosome 2 at 36,927,359 bp
  • T to C, chromosome 2 at 85,674,563 bp
  • A to G, chromosome 2 at 111,499,821 bp
  • G to C, chromosome 2 at 163,829,041 bp
  • T to C, chromosome 3 at 107,495,740 bp
  • T to A, chromosome 4 at 58,367,513 bp
  • T to C, chromosome 4 at 74,404,821 bp
  • A to C, chromosome 4 at 108,848,246 bp
  • G to T, chromosome 4 at 108,848,247 bp
  • A to G, chromosome 4 at 141,954,187 bp
  • T to A, chromosome 5 at 9,589,880 bp
  • T to A, chromosome 5 at 29,646,431 bp
  • A to T, chromosome 5 at 73,608,492 bp
  • T to A, chromosome 5 at 75,192,418 bp
  • A to G, chromosome 5 at 96,781,584 bp
  • A to T, chromosome 5 at 136,224,261 bp
  • A to G, chromosome 5 at 137,751,365 bp
  • T to A, chromosome 6 at 24,562,724 bp
  • C to T, chromosome 6 at 40,759,051 bp
  • T to C, chromosome 6 at 51,580,321 bp
  • G to A, chromosome 6 at 133,105,582 bp
  • C to A, chromosome 7 at 26,450,586 bp
  • C to T, chromosome 7 at 40,994,082 bp
  • T to C, chromosome 7 at 67,619,109 bp
  • T to C, chromosome 7 at 101,342,631 bp
  • T to A, chromosome 7 at 126,948,456 bp
  • T to C, chromosome 8 at 47,825,187 bp
  • T to C, chromosome 8 at 71,592,352 bp
  • C to T, chromosome 9 at 16,031,360 bp
  • A to G, chromosome 9 at 105,442,770 bp
  • T to C, chromosome 9 at 110,841,035 bp
  • ACTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGT to ACTCCAGGGGTGCACCCACCAGCTCCAGGGGTGCACCCACCAGCTCCAGGGGT, chromosome 10 at 80,804,437 bp
  • T to A, chromosome 10 at 83,190,954 bp
  • T to A, chromosome 11 at 5,803,007 bp
  • T to C, chromosome 11 at 35,844,163 bp
  • C to G, chromosome 11 at 59,112,555 bp
  • A to C, chromosome 11 at 72,180,501 bp
  • A to G, chromosome 11 at 73,724,536 bp
  • T to C, chromosome 11 at 78,291,623 bp
  • T to G, chromosome 11 at 101,083,696 bp
  • A to G, chromosome 11 at 101,508,146 bp
  • T to A, chromosome 11 at 120,715,880 bp
  • G to A, chromosome 12 at 35,515,068 bp
  • A to G, chromosome 14 at 43,261,566 bp
  • G to A, chromosome 14 at 123,973,323 bp
  • T to C, chromosome 15 at 54,462,371 bp
  • G to T, chromosome 16 at 30,260,801 bp
  • T to G, chromosome 16 at 88,506,645 bp
  • A to G, chromosome 17 at 25,816,906 bp
  • A to T, chromosome 17 at 35,077,918 bp
  • A to T, chromosome 17 at 63,863,397 bp
  • C to A, chromosome 18 at 5,118,357 bp
  • T to A, chromosome 19 at 41,063,803 bp
  • A to G, chromosome 19 at 43,807,112 bp
  • T to A, chromosome 19 at 53,813,322 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7925 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045972-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.