Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7928Btlr/Mmmh
Stock Number:
045975-MU
Citation ID:
RRID:MMRRC_045975-MU
Other Names:
R7928 (G1)
Major Collection:

Strain Information

Shh
Name: sonic hedgehog
Synonyms: Hhg1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20423
Homologene: 30961
App
Name: amyloid beta precursor protein
Synonyms: betaAPP, Abeta, protease nexin II, Adap, Cvap, appican, E030013M08Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 11820
VEGA: 16
HGNC: HGNC:620
Homologene: 56379
Dock4
Name: dedicator of cytokinesis 4
Synonyms: EST N28122, 6330411N01Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238130
VEGA: 12
Homologene: 56680
Fanci
Name: Fanconi anemia, complementation group I
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 208836
Homologene: 49530
Cntrob
Name: centrobin, centrosomal BRCA2 interacting protein
Synonyms: Lip8, 9830165K03Rik, Nip2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216846
Homologene: 14205
Zzef1
Name: zinc finger, ZZ-type with EF hand domain 1
Synonyms: 8430405D05Rik, C130099L13Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 195018
Homologene: 9027
Son
Name: Son DNA binding protein
Synonyms: 2900011L12Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 20658
Homologene: 10551
Rassf3
Name: Ras association (RalGDS/AF-6) domain family member 3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 192678
VEGA: 10
Homologene: 16365
Dmbt1
Name: deleted in malignant brain tumors 1
Synonyms: CRP-[b], CRP-[a], ebnerin, hensin, vomeroglandin, Crpd, MUCLIN, gp300
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12945
HGNC: HGNC:2926
Homologene: 68990
Dock7
Name: dedicator of cytokinesis 7
Synonyms: 3110056M06Rik, LOC242555, m
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 67299
Homologene: 23566
Sec13
Name: SEC13 homolog, nuclear pore and COPII coat complex component
Synonyms: 1110003H02Rik, Sec13r, Sec13l1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 110379
Homologene: 6479
Rnf13
Name: ring finger protein 13
Synonyms: Rzf, 2010001H16Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 24017
Homologene: 13493
Fancm
Name: Fanconi anemia, complementation group M
Synonyms: C730036B14Rik, D12Ertd364e
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 104806
VEGA: 12
Homologene: 35378
Dnah2
Name: dynein, axonemal, heavy chain 2
Synonyms: D330014H01Rik, 2900022L05Rik, Dnhd3, Dnahc2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 327954
HGNC: HGNC:2948
Homologene: 72110
Stil
Name: Scl/Tal1 interrupting locus
Synonyms: Sil
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 20460
Homologene: 2283
Rhbdf1
Name: rhomboid 5 homolog 1
Synonyms: Dist1, Egfr-rs, Dist
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 13650
Homologene: 32085
Evpl
Name: envoplakin
Synonyms: 210kDa protein
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14027
HGNC: HGNC:3503
Homologene: 1506
Adgrb1
Name: adhesion G protein-coupled receptor B1
Synonyms: B830018M07Rik, Bai1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 107831
HGNC: HGNC:943
Homologene: 1287
Gm5773
Name: predicted pseudogene 5773
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 436563
Adprhl1
Name: ADP-ribosylhydrolase like 1
Synonyms: Arh2, D330008N11Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234072
Homologene: 16311
Krtap4-23
Name: keratin associated protein 4-23
Synonyms: Gm11596
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 670464
Homologene: 124486
Cnot6l
Name: CCR4-NOT transcription complex, subunit 6-like
Synonyms: 4932442K20Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231464
Homologene: 100830
Dsn1
Name: DSN1 homolog, MIS12 kinetochore complex component
Synonyms: 1700022L09Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66934
Homologene: 49806
Vmn1r203
Name: vomeronasal 1 receptor 203
Synonyms: V1rh11
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 171270
Homologene: 110880
Rftn1
Name: raftlin lipid raft linker 1
Synonyms: 2310015N21Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 76438
Homologene: 18745
Sema6c
Name: sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6C
Synonyms: Sema Y, Semay
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20360
Homologene: 7931
Sgsh
Name: N-sulfoglucosamine sulfohydrolase (sulfamidase)
Synonyms: sulphamidase, 4632406A19Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 27029
Homologene: 167
Or52ae9
Name: olfactory receptor family 52 subfamily AE member 9
Synonyms: GA_x6K02T2PBJ9-6466772-6465828, MOR26-2, Olfr629
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258818
Homologene: 105159
Odam
Name: odontogenic, ameloblast asssociated
Synonyms: 2310011G06Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 69592
Homologene: 49511
Zfp950
Name: zinc finger protein 950
Synonyms: Zfp826, BC029127, Gm34518
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 414758
G530012D18Rik
Name: RIKEN cDNA G530012D1 gene
Type: Gene
Species: Mouse
Chromosome: 1
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to G, chromosome 1 at 85,577,214 bp
  • T to A, chromosome 2 at 91,176,888 bp
  • T to C, chromosome 2 at 157,006,012 bp
  • C to A, chromosome 3 at 57,764,308 bp
  • A to G, chromosome 3 at 93,773,690 bp
  • T to C, chromosome 3 at 95,172,309 bp
  • T to C, chromosome 4 at 99,001,098 bp
  • C to T, chromosome 4 at 115,030,001 bp
  • T to C, chromosome 5 at 28,461,406 bp
  • A to G, chromosome 5 at 87,887,410 bp
  • A to G, chromosome 5 at 96,131,068 bp
  • A to G, chromosome 6 at 113,729,640 bp
  • T to C, chromosome 7 at 79,444,711 bp
  • T to A, chromosome 7 at 103,741,190 bp
  • T to C, chromosome 7 at 131,037,890 bp
  • C to T, chromosome 8 at 13,248,682 bp
  • A to T, chromosome 10 at 77,814,889 bp
  • A to G, chromosome 10 at 121,417,079 bp
  • T to C, chromosome 11 at 32,209,898 bp
  • A to G, chromosome 11 at 69,300,295 bp
  • T to C, chromosome 11 at 69,430,835 bp
  • T to C, chromosome 11 at 72,821,896 bp
  • A to G, chromosome 11 at 99,792,796 bp
  • T to C, chromosome 11 at 116,222,533 bp
  • T to G, chromosome 11 at 119,347,735 bp
  • T to C, chromosome 12 at 40,788,303 bp
  • A to G, chromosome 12 at 65,106,124 bp
  • C to T, chromosome 13 at 22,524,535 bp
  • T to A, chromosome 15 at 74,538,321 bp
  • A to T, chromosome 16 at 84,978,246 bp
  • CATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAG to CATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAG, chromosome 16 at 91,656,841 bp
  • G to T, chromosome 17 at 50,047,380 bp
  • G to T, chromosome 19 at 61,119,500 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7928 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045975-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.