Strain Name:
C57BL/6J-MtgxR7929Btlr/Mmmh
Stock Number:
045976-MU
Citation ID:
RRID:MMRRC_045976-MU
Other Names:
R7929 (G1)
Major Collection:

Strain Information

Tle4
Name: transducin-like enhancer of split 4
Synonyms: ESTM13, ESTM14, 5730411M05Rik, Grg4, Bce1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 21888
VEGA: 19
Homologene: 38259
Gli2
Name: GLI-Kruppel family member GLI2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14633
HGNC: HGNC:4318
Homologene: 12725
Tesk2
Name: testis-specific kinase 2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230661
Homologene: 5188
Fkbp3
Name: FK506 binding protein 3
Synonyms: FKBP25, 25kDa
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 30795
VEGA: 12
HGNC: HGNC:3719
Homologene: 1525
Xpnpep3
Name: X-prolyl aminopeptidase 3, mitochondrial
Synonyms: E430012M05Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 321003
Gars1
Name: glycyl-tRNA synthetase 1
Synonyms: Gars, Gena201, GENA202, Sgrp23
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 353172
HGNC: HGNC:4162
Homologene: 1547
Tle1
Name: transducin-like enhancer of split 1
Synonyms: C230057C06Rik, Estm14, Tle4l, Grg1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 21885
Homologene: 21058
Ryr2
Name: ryanodine receptor 2, cardiac
Synonyms: 9330127I20Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20191
VEGA: 13
Homologene: 37423
Rxrb
Name: retinoid X receptor beta
Synonyms: H-2RIIBP, Nr2b2, RCoR-1, Rub
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 20182
Homologene: 7923
Ecpas
Name: Ecm29 proteasome adaptor and scaffold
Synonyms: AI314180
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230249
Homologene: 6056
Jak1
Name: Janus kinase 1
Synonyms: C130039L05Rik, BAP004
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 16451
HGNC: HGNC:6190
Homologene: 1678
Plekhg1
Name: pleckstrin homology domain containing, family G (with RhoGef domain) member 1
Synonyms: D10Ertd733e
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 213783
Homologene: 18897
Nxn
Name: nucleoredoxin
Synonyms: l11Jus13
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18230
Homologene: 69028
Apip
Name: APAF1 interacting protein
Synonyms: CGI-29, Mmrp19, APIP2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 56369
Homologene: 6277
Akap8
Name: A kinase anchor protein 8
Synonyms: AKAP95, 1200016A02Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 56399
VEGA: 17
HGNC: HGNC:378
Homologene: 4278
Tbk1
Name: TANK-binding kinase 1
Synonyms: 1200008B05Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 56480
VEGA: 10
Homologene: 22742
Klf16
Name: Kruppel-like transcription factor 16
Synonyms: BTEB4, DRRF
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 118445
Homologene: 136123
Nceh1
Name: neutral cholesterol ester hydrolase 1
Synonyms: mKIAA1363, Aadacl1, CPO-BP, B230106I24Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 320024
Homologene: 23251
Ttn
Name: titin
Synonyms: 2310074I15Rik, D330041I19Rik, 2310057K23Rik, connectin, 2310036G12Rik, shru, D830007G01Rik, L56, 1100001C23Rik, mdm
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Unc13b
Name: unc-13 homolog B
Synonyms: Munc13-2, Unc13h2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 22249
Homologene: 31376
Spata31
Name: spermatogenesis associated 31
Synonyms: 4930458L03Rik, Spata31a, Fam75a
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 78124
Homologene: 84621
Lama4
Name: laminin, alpha 4
Synonyms: laminin [a]4
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16775
HGNC: HGNC:6484
Homologene: 37604
Ephb2
Name: Eph receptor B2
Synonyms: Drt, Nuk, Cek5, Qek5, Sek3, eteck, Prkm5, Tyro5, Hek5, Erk
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13844
HGNC: HGNC:3393
Homologene: 37925
Ryr3
Name: ryanodine receptor 3
Synonyms: calcium release channel isoform 3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20192
Homologene: 68151
Nlrp2
Name: NLR family, pyrin domain containing 2
Synonyms: Pan1, Nalp2, Nbs1, E330007A02Rik, PYPAF2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 232827
Homologene: 56789
Odf4
Name: outer dense fiber of sperm tails 4
Synonyms: Oppo1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 252868
Homologene: 17099
Samd3
Name: sterile alpha motif domain containing 3
Synonyms: LOC268288
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 268288
VEGA: 10
Homologene: 67991
Ankrd50
Name: ankyrin repeat domain 50
Synonyms: E430012K20Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99696
Homologene: 129859
Ak9
Name: adenylate kinase 9
Synonyms: Akd1, Gm7127, Akd2, LOC215946
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 633979
Homologene: 67934
Il4ra
Name: interleukin 4 receptor, alpha
Synonyms: CD124, Il4r, IL-4 receptor alpha chain
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16190
HGNC: HGNC:6015
Homologene: 7784
Dennd3
Name: DENN domain containing 3
Synonyms: E030003N15Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 105841
Homologene: 28254
Il18rap
Name: interleukin 18 receptor accessory protein
Synonyms: AcPL accessory protein-like)
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16174
HGNC: HGNC:5989
Homologene: 2859
Vmn2r91
Name: vomeronasal 2, receptor 91
Synonyms: EG665210
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 665210
Homologene: 115024
Lrrc9
Name: leucine rich repeat containing 9
Synonyms: 4921529O18Rik, 4930432K16Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 78257
Homologene: 12692
Itprid1
Name: ITPR interacting domain containing 1
Synonyms: Ccdc129, D530004J12Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232016
Homologene: 52344
Adra1d
Name: adrenergic receptor, alpha 1d
Synonyms: Adra1a, Adra1, Adra-1, Gpcr8, alpha1D-AR
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11550
HGNC: HGNC:280
Homologene: 551
Adprhl1
Name: ADP-ribosylhydrolase like 1
Synonyms: D330008N11Rik, Arh2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234072
Homologene: 16311
Vmn2r107
Name: vomeronasal 2, receptor 107
Synonyms: V2r6
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 22312
Homologene: 129750
Zp3r
Name: zona pellucida 3 receptor
Synonyms: SP56
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22789
HGNC: HGNC:1325
Homologene: 7609
Klhl30
Name: kelch-like 30
Synonyms: 4631423F02Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 70788
Homologene: 18891
Lmtk3
Name: lemur tyrosine kinase 3
Synonyms: Aatyk3, AATYK3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 381983
Homologene: 79449
Kti12
Name: KTI12 homolog, chromatin associated
Synonyms: 1110001A12Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100087
Homologene: 6347
Or4d6
Name: olfactory receptor family 4 subfamily D member 6
Synonyms: GA_x6K02T2RE5P-2468394-2467450, Olfr1428, MOR239-5
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258673
Homologene: 17339
Pex12
Name: peroxisomal biogenesis factor 12
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 103737
HGNC: HGNC:8854
Homologene: 240
Slc2a5
Name: solute carrier family 2 (facilitated glucose transporter), member 5
Synonyms: GLUT5
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56485
Homologene: 74459
Atg4d
Name: autophagy related 4D, cysteine peptidase
Synonyms: Apg4d, Autl4, APG4-D, 9830134P12Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235040
VEGA: 9
Homologene: 13156
Sri
Name: sorcin
Synonyms: 2900070H08Rik, 2210417O06Rik, Sor
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 109552
Homologene: 37736
Tbx20
Name: T-box 20
Synonyms: 9430010M06Rik, Tbx12
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 57246
VEGA: 9
Homologene: 32476
Tulp1
Name: TUB like protein 1
Synonyms: Tulp1l
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 22157
Homologene: 2491
Disp1
Name: dispatched RND transporter family member 1
Synonyms: 1190008H24Rik, DispA
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 68897
Homologene: 14133
Ceacam16
Name: CEA cell adhesion molecule 16
Synonyms: LOC330483
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 330483
Homologene: 19857
Alyref2
Name: Aly/REF export factor 2
Synonyms: Refbp2, C130042O11Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 56009
Homologene: 98871
Ccdc86
Name: coiled-coil domain containing 86
Synonyms: cyclon, 4933411H20Rik, D19Ertd678e, 6720480F16Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 108673
Homologene: 41531
Or4p4b-ps1
Name: olfactory receptor family 4 subfamily P member 4B, pseudogene 1
Synonyms: GA_x6K02T2PRF0-25008-25939, MOR225-17_p, Olfr475-ps1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 404395
G530012D18Rik
Name: RIKEN cDNA G530012D1 gene
Type: Gene
Species: Mouse
Chromosome: 1
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 40,531,580 bp
  • C to G, chromosome 1 at 85,577,214 bp
  • A to T, chromosome 1 at 91,355,516 bp
  • A to T, chromosome 1 at 118,842,042 bp
  • T to A, chromosome 1 at 130,591,480 bp
  • C to G, chromosome 1 at 171,503,839 bp
  • A to G, chromosome 1 at 183,135,539 bp
  • G to A, chromosome 2 at 76,843,472 bp
  • T to C, chromosome 2 at 88,623,875 bp
  • A to C, chromosome 2 at 103,083,021 bp
  • A to G, chromosome 2 at 112,834,188 bp
  • G to T, chromosome 2 at 131,561,680 bp
  • A to G, chromosome 3 at 27,279,247 bp
  • A to T, chromosome 3 at 38,457,109 bp
  • A to G, chromosome 4 at 43,174,399 bp
  • A to G, chromosome 4 at 58,869,554 bp
  • A to G, chromosome 4 at 72,200,002 bp
  • A to T, chromosome 4 at 101,154,645 bp
  • A to C, chromosome 4 at 108,848,246 bp
  • G to T, chromosome 4 at 108,848,247 bp
  • A to G, chromosome 4 at 116,802,255 bp
  • A to G, chromosome 4 at 136,660,884 bp
  • C to A, chromosome 4 at 150,139,485 bp
  • T to G, chromosome 5 at 8,057,652 bp
  • A to G, chromosome 6 at 55,063,117 bp
  • G to A, chromosome 6 at 55,897,961 bp
  • A to G, chromosome 7 at 5,327,499 bp
  • A to G, chromosome 7 at 19,853,631 bp
  • A to G, chromosome 7 at 45,795,148 bp
  • T to C, chromosome 7 at 125,575,176 bp
  • C to T, chromosome 8 at 13,248,682 bp
  • A to T, chromosome 8 at 23,116,107 bp
  • GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA to GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA, chromosome 8 at 109,624,195 bp
  • G to A, chromosome 9 at 21,266,964 bp
  • A to T, chromosome 9 at 24,725,763 bp
  • G to A, chromosome 10 at 3,919,170 bp
  • A to G, chromosome 10 at 26,251,915 bp
  • A to G, chromosome 10 at 39,078,847 bp
  • A to G, chromosome 10 at 41,383,948 bp
  • A to G, chromosome 10 at 80,576,864 bp
  • A to G, chromosome 10 at 121,557,233 bp
  • A to T, chromosome 11 at 68,922,933 bp
  • A to G, chromosome 11 at 76,274,037 bp
  • A to G, chromosome 11 at 83,297,983 bp
  • A to G, chromosome 12 at 65,070,038 bp
  • C to A, chromosome 12 at 72,486,297 bp
  • T to A, chromosome 13 at 11,594,794 bp
  • T to A, chromosome 13 at 11,690,295 bp
  • T to A, chromosome 13 at 64,921,718 bp
  • G to T, chromosome 15 at 73,564,574 bp
  • A to G, chromosome 15 at 81,427,425 bp
  • T to G, chromosome 17 at 18,107,644 bp
  • T to G, chromosome 17 at 20,345,444 bp
  • T to C, chromosome 17 at 28,353,772 bp
  • A to T, chromosome 17 at 32,309,445 bp
  • T to A, chromosome 17 at 34,036,671 bp
  • T to A, chromosome 17 at 36,978,520 bp
  • A to G, chromosome 19 at 10,948,819 bp
  • G to A, chromosome 19 at 12,108,754 bp
  • G to T, chromosome 19 at 14,517,880 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7929 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045976-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.