Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7929Btlr/Mmmh
Stock Number:
045976-MU
Citation ID:
RRID:MMRRC_045976-MU
Other Names:
R7929 (G1)
Major Collection:

Strain Information

Tle4
Name: transducin-like enhancer of split 4
Synonyms: Grg4, ESTM13, ESTM14, Bce1, 5730411M05Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 21888
VEGA: 19
Homologene: 38259
Gli2
Name: GLI-Kruppel family member GLI2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14633
HGNC: HGNC:4318
Homologene: 12725
Tesk2
Name: testis-specific kinase 2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230661
Homologene: 5188
Fkbp3
Name: FK506 binding protein 3
Synonyms: FKBP25, 25kDa
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 30795
VEGA: 12
HGNC: HGNC:3719
Homologene: 1525
Xpnpep3
Name: X-prolyl aminopeptidase 3, mitochondrial
Synonyms: E430012M05Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 321003
Gars1
Name: glycyl-tRNA synthetase 1
Synonyms: Sgrp23, GENA202, Gena201, Gars
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 353172
HGNC: HGNC:4162
Homologene: 1547
Tle1
Name: transducin-like enhancer of split 1
Synonyms: Grg1, Estm14, C230057C06Rik, Tle4l
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 21885
Homologene: 21058
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 40,531,580 bp
  • C to G, chromosome 1 at 85,577,214 bp
  • A to T, chromosome 1 at 91,355,516 bp
  • A to T, chromosome 1 at 118,842,042 bp
  • T to A, chromosome 1 at 130,591,480 bp
  • C to G, chromosome 1 at 171,503,839 bp
  • A to G, chromosome 1 at 183,135,539 bp
  • G to A, chromosome 2 at 76,843,472 bp
  • T to C, chromosome 2 at 88,623,875 bp
  • A to C, chromosome 2 at 103,083,021 bp
  • A to G, chromosome 2 at 112,834,188 bp
  • G to T, chromosome 2 at 131,561,680 bp
  • A to G, chromosome 3 at 27,279,247 bp
  • A to T, chromosome 3 at 38,457,109 bp
  • A to G, chromosome 4 at 43,174,399 bp
  • A to G, chromosome 4 at 58,869,554 bp
  • A to G, chromosome 4 at 72,200,002 bp
  • A to T, chromosome 4 at 101,154,645 bp
  • A to C, chromosome 4 at 108,848,246 bp
  • G to T, chromosome 4 at 108,848,247 bp
  • A to G, chromosome 4 at 116,802,255 bp
  • A to G, chromosome 4 at 136,660,884 bp
  • C to A, chromosome 4 at 150,139,485 bp
  • T to G, chromosome 5 at 8,057,652 bp
  • A to G, chromosome 6 at 55,063,117 bp
  • G to A, chromosome 6 at 55,897,961 bp
  • A to G, chromosome 7 at 5,327,499 bp
  • A to G, chromosome 7 at 19,853,631 bp
  • A to G, chromosome 7 at 45,795,148 bp
  • T to C, chromosome 7 at 125,575,176 bp
  • C to T, chromosome 8 at 13,248,682 bp
  • A to T, chromosome 8 at 23,116,107 bp
  • GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA to GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA, chromosome 8 at 109,624,195 bp
  • G to A, chromosome 9 at 21,266,964 bp
  • A to T, chromosome 9 at 24,725,763 bp
  • G to A, chromosome 10 at 3,919,170 bp
  • A to G, chromosome 10 at 26,251,915 bp
  • A to G, chromosome 10 at 39,078,847 bp
  • A to G, chromosome 10 at 41,383,948 bp
  • A to G, chromosome 10 at 80,576,864 bp
  • A to G, chromosome 10 at 121,557,233 bp
  • A to T, chromosome 11 at 68,922,933 bp
  • A to G, chromosome 11 at 76,274,037 bp
  • A to G, chromosome 11 at 83,297,983 bp
  • A to G, chromosome 12 at 65,070,038 bp
  • C to A, chromosome 12 at 72,486,297 bp
  • T to A, chromosome 13 at 11,594,794 bp
  • T to A, chromosome 13 at 11,690,295 bp
  • T to A, chromosome 13 at 64,921,718 bp
  • G to T, chromosome 15 at 73,564,574 bp
  • A to G, chromosome 15 at 81,427,425 bp
  • T to G, chromosome 17 at 18,107,644 bp
  • T to G, chromosome 17 at 20,345,444 bp
  • T to C, chromosome 17 at 28,353,772 bp
  • A to T, chromosome 17 at 32,309,445 bp
  • T to A, chromosome 17 at 34,036,671 bp
  • T to A, chromosome 17 at 36,978,520 bp
  • A to G, chromosome 19 at 10,948,819 bp
  • G to A, chromosome 19 at 12,108,754 bp
  • G to T, chromosome 19 at 14,517,880 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7929 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045976-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.