Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7939Btlr/Mmmh
Stock Number:
045985-MU
Citation ID:
RRID:MMRRC_045985-MU
Other Names:
R7939 (G1)
Major Collection:

Strain Information

Myo5a
Name: myosin VA
Synonyms: MVa, MyoVA, Myo5, flail, 9630007J19Rik, Dbv
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17918
HGNC: HGNC:7602
Homologene: 20100
Adgre1
Name: adhesion G protein-coupled receptor E1
Synonyms: F4/80, DD7A5-7, TM7LN3, EGF-TM7, Ly71, Emr1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 13733
VEGA: 17
HGNC: HGNC:3336
Homologene: 1493
Pigl
Name: phosphatidylinositol glycan anchor biosynthesis, class L
Synonyms: LOC327942
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 327942
HGNC: HGNC:8966
Homologene: 3159
Traip
Name: TRAF-interacting protein
Synonyms: Trip
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 22036
Homologene: 31343
Mast2
Name: microtubule associated serine/threonine kinase 2
Synonyms: MAST205, Mtssk
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 17776
Homologene: 7428
Kifap3
Name: kinesin-associated protein 3
Synonyms: KAP3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16579
Homologene: 7799
Taok3
Name: TAO kinase 3
Synonyms: A430105I05Rik, 2900006A08Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 330177
Homologene: 83279
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 32,172,975 bp
  • C to T, chromosome 1 at 87,149,534 bp
  • A to G, chromosome 1 at 90,214,565 bp
  • T to C, chromosome 1 at 93,560,261 bp
  • T to G, chromosome 1 at 151,706,024 bp
  • C to T, chromosome 1 at 162,295,596 bp
  • C to A, chromosome 1 at 163,815,858 bp
  • T to C, chromosome 2 at 52,186,061 bp
  • A to G, chromosome 2 at 73,909,862 bp
  • A to T, chromosome 2 at 76,712,393 bp
  • A to T, chromosome 2 at 76,745,761 bp
  • A to T, chromosome 2 at 90,464,665 bp
  • G to T, chromosome 2 at 93,012,729 bp
  • G to A, chromosome 2 at 93,730,256 bp
  • A to G, chromosome 2 at 181,237,750 bp
  • A to T, chromosome 3 at 88,074,638 bp
  • C to A, chromosome 3 at 108,080,116 bp
  • G to A, chromosome 4 at 103,096,601 bp
  • A to T, chromosome 4 at 116,167,012 bp
  • A to T, chromosome 4 at 116,430,471 bp
  • G to T, chromosome 4 at 135,807,278 bp
  • A to T, chromosome 4 at 145,702,012 bp
  • G to T, chromosome 4 at 155,002,778 bp
  • T to A, chromosome 5 at 33,855,589 bp
  • T to C, chromosome 5 at 45,450,065 bp
  • T to A, chromosome 5 at 109,339,839 bp
  • T to C, chromosome 5 at 109,942,494 bp
  • T to C, chromosome 5 at 117,193,837 bp
  • G to A, chromosome 6 at 72,604,936 bp
  • A to T, chromosome 6 at 83,051,564 bp
  • T to C, chromosome 6 at 124,462,199 bp
  • T to C, chromosome 7 at 43,574,877 bp
  • C to A, chromosome 7 at 64,314,151 bp
  • C to T, chromosome 7 at 79,792,986 bp
  • T to A, chromosome 7 at 107,967,779 bp
  • T to C, chromosome 7 at 108,881,274 bp
  • T to C, chromosome 7 at 142,136,031 bp
  • C to A, chromosome 8 at 54,687,642 bp
  • A to G, chromosome 8 at 86,548,804 bp
  • T to C, chromosome 8 at 116,889,774 bp
  • A to T, chromosome 8 at 122,891,073 bp
  • T to C, chromosome 9 at 42,388,223 bp
  • T to G, chromosome 9 at 64,928,366 bp
  • A to G, chromosome 9 at 75,189,900 bp
  • T to C, chromosome 9 at 107,955,878 bp
  • T to A, chromosome 10 at 79,478,817 bp
  • A to T, chromosome 10 at 128,544,507 bp
  • T to C, chromosome 11 at 54,502,267 bp
  • C to A, chromosome 11 at 61,224,598 bp
  • T to C, chromosome 11 at 62,458,680 bp
  • C to A, chromosome 11 at 67,030,024 bp
  • GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC to GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC, chromosome 11 at 96,099,982 bp
  • A to G, chromosome 12 at 87,221,331 bp
  • A to T, chromosome 13 at 61,356,550 bp
  • A to G, chromosome 13 at 66,995,347 bp
  • A to T, chromosome 13 at 67,474,503 bp
  • T to C, chromosome 14 at 54,367,419 bp
  • C to A, chromosome 14 at 63,534,524 bp
  • C to T, chromosome 14 at 73,029,959 bp
  • T to C, chromosome 15 at 58,048,650 bp
  • A to T, chromosome 17 at 12,981,796 bp
  • A to T, chromosome 17 at 25,722,137 bp
  • A to C, chromosome 17 at 29,340,832 bp
  • G to T, chromosome 17 at 57,449,938 bp
  • T to A, chromosome 18 at 36,947,880 bp
  • T to C, chromosome 18 at 36,976,010 bp
  • T to A, chromosome 19 at 9,014,084 bp
  • C to T, chromosome 19 at 16,740,791 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7939 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045985-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.