Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7939Btlr/Mmmh
Stock Number:
045985-MU
Citation ID:
RRID:MMRRC_045985-MU
Other Names:
R7939 (G1)
Major Collection:

Strain Information

Myo5a
Name: myosin VA
Synonyms: MVa, MyoVA, Myo5, flail, 9630007J19Rik, Dbv
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17918
HGNC: HGNC:7602
Homologene: 20100
Adgre1
Name: adhesion G protein-coupled receptor E1
Synonyms: F4/80, DD7A5-7, TM7LN3, EGF-TM7, Ly71, Emr1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 13733
VEGA: 17
HGNC: HGNC:3336
Homologene: 1493
Pigl
Name: phosphatidylinositol glycan anchor biosynthesis, class L
Synonyms: LOC327942
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 327942
HGNC: HGNC:8966
Homologene: 3159
Traip
Name: TRAF-interacting protein
Synonyms: Trip
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 22036
Homologene: 31343
Mast2
Name: microtubule associated serine/threonine kinase 2
Synonyms: MAST205, Mtssk
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 17776
Homologene: 7428
Kifap3
Name: kinesin-associated protein 3
Synonyms: KAP3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16579
Homologene: 7799
Taok3
Name: TAO kinase 3
Synonyms: A430105I05Rik, 2900006A08Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 330177
Homologene: 83279
Ankrd11
Name: ankyrin repeat domain 11
Synonyms: 2410104C19Rik, 9530048I21Rik, 3010027A04Rik, Yod
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 77087
Homologene: 69134
Ptprj
Name: protein tyrosine phosphatase receptor type J
Synonyms: Byp, DEP-1, Scc-1, Scc1, CD148, RPTPJ
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19271
HGNC: HGNC:9673
Homologene: 2130
Ackr3
Name: atypical chemokine receptor 3
Synonyms: Rdc1, Cmkor1, Cxcr7
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12778
Homologene: 22419
Ecel1
Name: endothelin converting enzyme-like 1
Synonyms: DINE, XCE
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13599
HGNC: HGNC:3147
Homologene: 3549
Mtch1
Name: mitochondrial carrier 1
Synonyms: 2310034O17Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 56462
Homologene: 22807
Zfp980
Name: zinc finger protein 980
Synonyms: Gm13242
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100041379
Homologene: 133076
Atp5mc3
Name: ATP synthase membrane subunit c locus 3
Synonyms: Atp5g3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228033
HGNC: HGNC:843
Homologene: 133873
Nsd2
Name: nuclear receptor binding SET domain protein 2
Synonyms: 5830445G22Rik, Whsc1l, 9430010A17Rik, D030027O06Rik, C130020C13Rik, D930023B08Rik, Whsc1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 107823
Homologene: 26175
Ampd2
Name: adenosine monophosphate deaminase 2
Synonyms: Ampd-2, 1200014F01Rik, m4521Dajl
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 109674
HGNC: HGNC:469
Homologene: 2979
Ext2
Name: exostosin glycosyltransferase 2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14043
HGNC: HGNC:3513
Homologene: 345
Wtap
Name: WT1 associating protein
Synonyms: 9430038B09Rik, 2810408K05Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 60532
Homologene: 68422
Mtmr9
Name: myotubularin related protein 9
Synonyms: mMTMH3, LIP-STYX, MTMR8, 9430075G12Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 210376
VEGA: 14
Homologene: 9148
Vps13a
Name: vacuolar protein sorting 13A
Synonyms: 4930516E05Rik, D330038K10Rik, 4930543C13Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 271564
VEGA: 19
HGNC: HGNC:1908
Homologene: 22068
Fnip1
Name: folliculin interacting protein 1
Synonyms: A730024A03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216742
Homologene: 28173
Retsat
Name: retinol saturase (all trans retinol 13,14 reductase)
Synonyms: 0610039N19Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67442
Homologene: 41195
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Tecta
Name: tectorin alpha
Synonyms: [a]-tectorin, Tctna
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 21683
Homologene: 3955
Wdr17
Name: WD repeat domain 17
Synonyms: 3010002I12Rik, B230207L18Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244484
Homologene: 12460
Helz2
Name: helicase with zinc finger 2, transcriptional coactivator
Synonyms: BC006779
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 229003
Homologene: 14118
Abcc12
Name: ATP-binding cassette, sub-family C member 12
Synonyms: MRP9, 4930467B22Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244562
Homologene: 57211
Farp2
Name: FERM, RhoGEF and pleckstrin domain protein 2
Synonyms: Fir, D030026M03Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227377
Homologene: 8877
Khdrbs2
Name: KH domain containing, RNA binding, signal transduction associated 2
Synonyms: SLM-1, 6330586C16Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 170771
Homologene: 15772
Chtf18
Name: CTF18, chromosome transmission fidelity factor 18
Synonyms: 6030457M03Rik, CTF18
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 214901
Homologene: 32532
Clstn3
Name: calsyntenin 3
Synonyms: Cst-3, CSTN3, alcadein-beta, Clstn3b
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232370
Homologene: 22836
Ahnak
Name: AHNAK nucleoprotein
Synonyms: DY6, 2310047C17Rik, 1110004P15Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 66395
VEGA: 19
HGNC: HGNC:347
Homologene: 67425
Dnm3
Name: dynamin 3
Synonyms: B230343F03Rik, 9630020E24Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 103967
Homologene: 22906
Dnai4
Name: dynein axonemal intermediate chain 4
Synonyms: Wdr78
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242584
Homologene: 11702
Slc24a1
Name: solute carrier family 24 (sodium/potassium/calcium exchanger), member 1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 214111
VEGA: 9
Homologene: 3472
Vmn2r83
Name: vomeronasal 2, receptor 83
Synonyms: EG625029
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 625029
Homologene: 83669
Aldh3a2
Name: aldehyde dehydrogenase family 3, subfamily A2
Synonyms: Ahd-3r, Ahd-3, Ahd3-r, Ahd3, Aldh4, Aldh4-r, FALDH
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 11671
HGNC: HGNC:403
Homologene: 55458
Plch2
Name: phospholipase C, eta 2
Synonyms: PLCeta2, A930027K05Rik, Plcl4
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 269615
Homologene: 85172
Zfp175
Name: zinc finger protein 175
Synonyms: Zfp658
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 210104
Homologene: 134007
Ttc24
Name: tetratricopeptide repeat domain 24
Synonyms: A430025D11Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 214191
Homologene: 82282
Oxa1l
Name: oxidase assembly 1-like
Synonyms: 1810020M02Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 69089
HGNC: HGNC:8526
Homologene: 31281
Niban1
Name: niban apoptosis regulator 1
Synonyms: Niban, Fam129a
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 63913
Homologene: 62170
Noxred1
Name: NADP+ dependent oxidoreductase domain containing 1
Synonyms: 4933437F05Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 71275
VEGA: 12
Homologene: 51388
Myom3
Name: myomesin family, member 3
Synonyms: 8430427K15Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242702
Homologene: 19432
Vmn2r16
Name: vomeronasal 2, receptor 16
Synonyms: EG384220
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 384220
Homologene: 104825
Mtmr10
Name: myotubularin related protein 10
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233315
Homologene: 9822
Zc3h10
Name: zinc finger CCCH type containing 10
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 103284
Homologene: 13114
Ptdss1
Name: phosphatidylserine synthase 1
Synonyms: PtdSer Synthase-1, PSS-1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 19210
VEGA: 13
HGNC: HGNC:9587
Homologene: 7494
Zfp874b
Name: zinc finger protein 874b
Synonyms: 9630025I21Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 408067
Homologene: 135597
Tmem220
Name: transmembrane protein 220
Synonyms: A730055C05Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 338369
Homologene: 18579
Prdm11
Name: PR domain containing 11
Synonyms: 8030443D09Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 100042784
Homologene: 82511
Or5p55
Name: olfactory receptor family 5 subfamily P member 55
Synonyms: GA_x6K02T2PBJ9-10296787-10297719, MOR204-3, Olfr476
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258926
Mesp1
Name: mesoderm posterior 1
Synonyms: bHLHc5
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17292
Homologene: 32039
Calcoco2
Name: calcium binding and coiled-coil domain 2
Synonyms: 2410154J16Rik, Ndp52l1, Ndp52
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76815
Cts7
Name: cathepsin 7
Synonyms: Epcs71, Epcs24, CTS1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 56092
VEGA: 13
Homologene: 75110
Or10a3
Name: olfactory receptor family 10 subfamily A member 3
Synonyms: GA_x6K02T2PBJ9-11211854-11210853, MOR268-5, Olfr518
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258303
Homologene: 133601
Qdpr
Name: quinoid dihydropteridine reductase
Synonyms: 2610008L04Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 110391
HGNC: HGNC:9752
Homologene: 271
Cysltr2
Name: cysteinyl leukotriene receptor 2
Synonyms: CYSLT2R, Cyslt2, CysLT2, 2300001H05Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 70086
VEGA: 14
Homologene: 10688
Cmc2
Name: C-X9-C motif containing 2
Synonyms: 1110046L09Rik, 2310061C15Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 66531
Homologene: 41350
Tspan1
Name: tetraspanin 1
Synonyms: 9030418M05Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 66805
Homologene: 21170
Htra2
Name: HtrA serine peptidase 2
Synonyms: HtrA2, OMI, mnd2, Prss25
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 64704
Homologene: 113300
Pcdha3
Name: protocadherin alpha 3
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 192163
HGNC: HGNC:8669
Homologene: 129613
Pcdha7
Name: protocadherin alpha 7
Synonyms: Cnr4, Crnr4
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 12939
Homologene: 117962
Gm29394
Name: predicted gene 29394
Type: Gene
Species: Mouse
Chromosome: 15
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 32,172,975 bp
  • C to T, chromosome 1 at 87,149,534 bp
  • A to G, chromosome 1 at 90,214,565 bp
  • T to C, chromosome 1 at 93,560,261 bp
  • T to G, chromosome 1 at 151,706,024 bp
  • C to T, chromosome 1 at 162,295,596 bp
  • C to A, chromosome 1 at 163,815,858 bp
  • T to C, chromosome 2 at 52,186,061 bp
  • A to G, chromosome 2 at 73,909,862 bp
  • A to T, chromosome 2 at 76,712,393 bp
  • A to T, chromosome 2 at 76,745,761 bp
  • A to T, chromosome 2 at 90,464,665 bp
  • G to T, chromosome 2 at 93,012,729 bp
  • G to A, chromosome 2 at 93,730,256 bp
  • A to G, chromosome 2 at 181,237,750 bp
  • A to T, chromosome 3 at 88,074,638 bp
  • C to A, chromosome 3 at 108,080,116 bp
  • G to A, chromosome 4 at 103,096,601 bp
  • A to T, chromosome 4 at 116,167,012 bp
  • A to T, chromosome 4 at 116,430,471 bp
  • G to T, chromosome 4 at 135,807,278 bp
  • A to T, chromosome 4 at 145,702,012 bp
  • G to T, chromosome 4 at 155,002,778 bp
  • T to A, chromosome 5 at 33,855,589 bp
  • T to C, chromosome 5 at 45,450,065 bp
  • T to A, chromosome 5 at 109,339,839 bp
  • T to C, chromosome 5 at 109,942,494 bp
  • T to C, chromosome 5 at 117,193,837 bp
  • G to A, chromosome 6 at 72,604,936 bp
  • A to T, chromosome 6 at 83,051,564 bp
  • T to C, chromosome 6 at 124,462,199 bp
  • T to C, chromosome 7 at 43,574,877 bp
  • C to A, chromosome 7 at 64,314,151 bp
  • C to T, chromosome 7 at 79,792,986 bp
  • T to A, chromosome 7 at 107,967,779 bp
  • T to C, chromosome 7 at 108,881,274 bp
  • T to C, chromosome 7 at 142,136,031 bp
  • C to A, chromosome 8 at 54,687,642 bp
  • A to G, chromosome 8 at 86,548,804 bp
  • T to C, chromosome 8 at 116,889,774 bp
  • A to T, chromosome 8 at 122,891,073 bp
  • T to C, chromosome 9 at 42,388,223 bp
  • T to G, chromosome 9 at 64,928,366 bp
  • A to G, chromosome 9 at 75,189,900 bp
  • T to C, chromosome 9 at 107,955,878 bp
  • T to A, chromosome 10 at 79,478,817 bp
  • A to T, chromosome 10 at 128,544,507 bp
  • T to C, chromosome 11 at 54,502,267 bp
  • C to A, chromosome 11 at 61,224,598 bp
  • T to C, chromosome 11 at 62,458,680 bp
  • C to A, chromosome 11 at 67,030,024 bp
  • GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC to GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC, chromosome 11 at 96,099,982 bp
  • A to G, chromosome 12 at 87,221,331 bp
  • A to T, chromosome 13 at 61,356,550 bp
  • A to G, chromosome 13 at 66,995,347 bp
  • A to T, chromosome 13 at 67,474,503 bp
  • T to C, chromosome 14 at 54,367,419 bp
  • C to A, chromosome 14 at 63,534,524 bp
  • C to T, chromosome 14 at 73,029,959 bp
  • T to C, chromosome 15 at 58,048,650 bp
  • A to T, chromosome 17 at 12,981,796 bp
  • A to T, chromosome 17 at 25,722,137 bp
  • A to C, chromosome 17 at 29,340,832 bp
  • G to T, chromosome 17 at 57,449,938 bp
  • T to A, chromosome 18 at 36,947,880 bp
  • T to C, chromosome 18 at 36,976,010 bp
  • T to A, chromosome 19 at 9,014,084 bp
  • C to T, chromosome 19 at 16,740,791 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7939 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045985-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.