Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7941Btlr/Mmmh
Stock Number:
045987-MU
Citation ID:
RRID:MMRRC_045987-MU
Other Names:
R7941 (G1)
Major Collection:

Strain Information

Hyal1
Name: hyaluronoglucosaminidase 1
Synonyms: Hyal-1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 15586
HGNC: HGNC:5320
Homologene: 5277
Elavl3
Name: ELAV like RNA binding protein 3
Synonyms: mHuC, Huc, 2600009P04Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 15571
VEGA: 9
HGNC: HGNC:3314
Homologene: 31035
Ip6k1
Name: inositol hexaphosphate kinase 1
Synonyms: InsP6, 1200016D08Rik, Ihpk1, InsP6k1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 27399
Homologene: 56602
Fam222b
Name: family with sequence similarity 222, member B
Synonyms: BC017647
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216971
Homologene: 10054
Cenpf
Name: centromere protein F
Synonyms: 6530404A22Rik, Lek1, mitosin
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 108000
HGNC: HGNC:1857
Homologene: 22969
Abl1
Name: Abl proto-oncogene 1, non-receptor tyrosine kinase
Synonyms: c-Abl, E430008G22Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11350
HGNC: HGNC:76
Homologene: 3783
Dusp5
Name: dual specificity phosphatase 5
Synonyms: LOC240672
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 240672
HGNC: HGNC:3071
Homologene: 3256
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 38,871,691 bp
  • A to G, chromosome 1 at 150,650,084 bp
  • A to G, chromosome 1 at 189,657,286 bp
  • A to G, chromosome 2 at 26,376,718 bp
  • T to C, chromosome 2 at 31,689,679 bp
  • T to A, chromosome 2 at 70,594,585 bp
  • A to G, chromosome 2 at 76,919,350 bp
  • T to C, chromosome 2 at 87,628,904 bp
  • T to G, chromosome 2 at 101,642,346 bp
  • T to A, chromosome 2 at 149,899,788 bp
  • C to A, chromosome 3 at 108,080,116 bp
  • G to A, chromosome 4 at 55,531,755 bp
  • A to G, chromosome 4 at 81,282,750 bp
  • A to T, chromosome 4 at 100,988,173 bp
  • C to A, chromosome 4 at 112,625,990 bp
  • A to G, chromosome 5 at 6,770,042 bp
  • A to T, chromosome 5 at 93,638,028 bp
  • A to T, chromosome 5 at 108,996,440 bp
  • A to G, chromosome 7 at 11,517,672 bp
  • T to A, chromosome 7 at 18,681,177 bp
  • T to G, chromosome 7 at 30,973,095 bp
  • T to C, chromosome 7 at 52,003,413 bp
  • T to A, chromosome 7 at 83,682,829 bp
  • A to G, chromosome 7 at 127,092,421 bp
  • GTCCTCCTCCTCCTCCTCCTGCTCCTCCTCCTCCTCCT to GTCCTCCTCCTCCTCCTGCTCCTCCTCCTCCTCCT, chromosome 7 at 127,558,290 bp
  • A to G, chromosome 9 at 22,036,316 bp
  • T to C, chromosome 9 at 107,578,100 bp
  • T to C, chromosome 9 at 108,024,432 bp
  • C to T, chromosome 10 at 41,409,137 bp
  • T to C, chromosome 10 at 59,007,061 bp
  • A to T, chromosome 10 at 90,577,155 bp
  • A to T, chromosome 10 at 107,806,802 bp
  • GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT to GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT, chromosome 10 at 116,283,677 bp
  • A to G, chromosome 10 at 127,743,540 bp
  • A to T, chromosome 11 at 74,659,757 bp
  • G to T, chromosome 11 at 78,155,059 bp
  • A to G, chromosome 13 at 4,059,713 bp
  • C to T, chromosome 13 at 55,320,307 bp
  • A to G, chromosome 15 at 26,543,613 bp
  • T to C, chromosome 16 at 44,215,561 bp
  • C to T, chromosome 16 at 55,821,944 bp
  • T to C, chromosome 17 at 18,184,837 bp
  • T to C, chromosome 17 at 33,931,739 bp
  • T to C, chromosome 17 at 33,999,331 bp
  • A to T, chromosome 17 at 94,733,194 bp
  • T to C, chromosome 18 at 12,744,768 bp
  • T to C, chromosome 18 at 38,199,080 bp
  • A to T, chromosome 18 at 41,932,751 bp
  • A to T, chromosome 18 at 84,015,392 bp
  • T to C, chromosome 19 at 10,271,503 bp
  • T to C, chromosome 19 at 29,533,259 bp
  • A to G, chromosome 19 at 53,537,533 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7941 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045987-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.