Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7947Btlr/Mmmh
Stock Number:
045992-MU
Citation ID:
RRID:MMRRC_045992-MU
Other Names:
R7947 (G1)
Major Collection:

Strain Information

Cacna1g
Name: calcium channel, voltage-dependent, T type, alpha 1G subunit
Synonyms: a1G, Cav3.1d
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12291
HGNC: HGNC:1394
Homologene: 22544
Slit1
Name: slit guidance ligand 1
Synonyms: Slil1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20562
Homologene: 2302
Macf1
Name: microtubule-actin crosslinking factor 1
Synonyms: Acf7, Aclp7, trabeculin alpha
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11426
Homologene: 136191
Phf14
Name: PHD finger protein 14
Synonyms: 1110001C23Rik, 4932409F11Rik, 5730446A07Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 75725
Homologene: 8775
Sgpl1
Name: sphingosine phosphate lyase 1
Synonyms: D10Xrf456
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 20397
Homologene: 2897
Arhgef18
Name: Rho/Rac guanine nucleotide exchange factor 18
Synonyms: D030053O22Rik, A430078G23Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 102098
Homologene: 32254
Abcc8
Name: ATP-binding cassette, sub-family C member 8
Synonyms: SUR1, Sur, D930031B21Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20927
HGNC: HGNC:59
Homologene: 68048
Kntc1
Name: kinetochore associated 1
Synonyms: jgl
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 208628
Homologene: 32227
Ints4
Name: integrator complex subunit 4
Synonyms: 2610034N24Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101861
Homologene: 69427
Nusap1
Name: nucleolar and spindle associated protein 1
Synonyms: NuSAP, 2610201A12Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 108907
Homologene: 10207
Axin2
Name: axin 2
Synonyms: Axil, Conductin
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12006
HGNC: HGNC:904
Homologene: 3420
Stim2
Name: stromal interaction molecule 2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 116873
Homologene: 32490
Bmal1
Name: basic helix-loop-helix ARNT like 1
Synonyms: Arnt3, MOP3, bHLHe5, Arntl
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11865
HGNC: HGNC:701
Homologene: 910
Mms22l
Name: MMS22-like, DNA repair protein
Synonyms: F730047E07Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 212377
Homologene: 18874
Spg11
Name: SPG11, spatacsin vesicle trafficking associated
Synonyms: C530005A01Rik, 6030465E24Rik, spastic paraplegia 11
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 214585
Homologene: 41614
Mcf2l
Name: mcf.2 transforming sequence-like
Synonyms: Dbs, C130040G20Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 17207
Homologene: 11804
Shld2
Name: shieldin complex subunit 2
Synonyms: 3110001K24Rik, Fam35a
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 75698
VEGA: 14
Homologene: 56840
Kifc1
Name: kinesin family member C1
Synonyms: Tctex-7, Tctex-7A, Tctex7, Tctex7a, kinesin family c-terminal 5A, HSET, KNSL2, Kifc5a, Gm4137, Knsl2a
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 100502766
HGNC: HGNC:6389
Homologene: 83229
Tnc
Name: tenascin C
Synonyms: Hxb, TN-C, TN, C130033P17Rik, tenascin-C, cytotactin, hexabrachion
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 21923
HGNC: HGNC:5318
Homologene: 55636
Fgfrl1
Name: fibroblast growth factor receptor-like 1
Synonyms: fibroblast growth factor receptor 5, FGFR5gamma, FGFR5beta, FGFR5
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 116701
HGNC: HGNC:3693
Homologene: 11067
Arnt
Name: aryl hydrocarbon receptor nuclear translocator
Synonyms: Hif1b, ESTM42, D3Ertd557e, bHLHe2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 11863
HGNC: HGNC:700
Homologene: 1261
Pigk
Name: phosphatidylinositol glycan anchor biosynthesis, class K
Synonyms: 3000001O05Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 329777
HGNC: HGNC:8965
Homologene: 4002
Fam118b
Name: family with sequence similarity 118, member B
Synonyms: 2310022O21Rik, 2700018L24Rik, C030004A17Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 109229
Homologene: 11584
Zfp266
Name: zinc finger protein 266
Synonyms: 5330440G10Rik, 5730601F06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 77519
Homologene: 105676
Tepsin
Name: TEPSIN, adaptor related protein complex 4 accessory protein
Synonyms: 2410002I01Rik, Enthd2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 78777
Homologene: 35359
AW209491
Name: expressed sequence AW209491
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 105351
VEGA: 13
Homologene: 11439
Tmem207
Name: transmembrane protein 207
Synonyms: LOC224058, 100043057
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 100043057
VEGA: 16
Homologene: 52611
Ret
Name: ret proto-oncogene
Synonyms: RET51, RET9, c-Ret
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 19713
HGNC: HGNC:9967
Homologene: 7517
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Fat2
Name: FAT atypical cadherin 2
Synonyms: LOC245827, mKIAA0811, Fath2, EMI2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 245827
HGNC: HGNC:3596
Homologene: 1110
Avl9
Name: AVL9 cell migration associated
Synonyms: D730049P16Rik, 5830411G16Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 78937
Homologene: 62425
Art3
Name: ADP-ribosyltransferase 3
Synonyms: 4930569O04Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 109979
HGNC: HGNC:725
Homologene: 911
Syde1
Name: synapse defective 1, Rho GTPase, homolog 1 (C. elegans)
Synonyms: 1200008N06Rik, mSYD1A
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 71709
VEGA: 10
Homologene: 13195
Stab2
Name: stabilin 2
Synonyms: STAB-2, FEEL-2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 192188
Homologene: 23022
Slc22a1
Name: solute carrier family 22 (organic cation transporter), member 1
Synonyms: Lx1, Oct1, Orct, Oct1, Orct1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 20517
VEGA: 17
Homologene: 20665
Rb1cc1
Name: RB1-inducible coiled-coil 1
Synonyms: LaXp180, 2900055E04Rik, Cc1, 5930404L04Rik, Fip200
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12421
Homologene: 7659
Accs
Name: 1-aminocyclopropane-1-carboxylate synthase (inactive)
Synonyms: 2610203E10Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 329470
Homologene: 75335
Tshz1
Name: teashirt zinc finger family member 1
Synonyms: NY-CO-33, D18Bwg1409e, 5730407I04Rik, Mtsh1, Sdccag33, teashirt1, Tsh1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 110796
Homologene: 4227
Erich6
Name: glutamate rich 6
Synonyms: 4932431H17Rik, Fam194a
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 545527
Homologene: 65043
Dthd1
Name: death domain containing 1
Synonyms: Gm17384
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100322896
Homologene: 123510
Phykpl
Name: 5-phosphohydroxy-L-lysine phospholyase
Synonyms: 2900006B13Rik, Agxt2l2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 72947
Homologene: 75268
Krt2
Name: keratin 2
Synonyms: Krt2-2, Krt2e, Krt2-17
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 16681
HGNC: HGNC:6439
Zfp777
Name: zinc finger protein 777
Synonyms: 2500002G23Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 72306
Homologene: 56721
Adprhl1
Name: ADP-ribosylhydrolase like 1
Synonyms: Arh2, D330008N11Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234072
Homologene: 16311
Fcgbp
Name: Fc fragment of IgG binding protein
Synonyms: A430096B05Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 215384
Homologene: 68369
Khnyn
Name: KH and NYN domain containing
Synonyms: 9130227C08Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219094
VEGA: 14
Homologene: 23611
Crlf1
Name: cytokine receptor-like factor 1
Synonyms: CLF-1, cytokine receptor like molecule 3, CRLM3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12931
HGNC: HGNC:2364
Homologene: 3489
C1ra
Name: complement component 1, r subcomponent A
Synonyms: mC1rA
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 50909
HGNC: HGNC:1246
Homologene: 1313
Nipsnap1
Name: nipsnap homolog 1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18082
HGNC: HGNC:7827
Homologene: 2695
Ace
Name: angiotensin I converting enzyme
Synonyms: CD143
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 11421
HGNC: HGNC:2707
Homologene: 37351
Sec61a2
Name: SEC61 translocon subunit alpha 2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 57743
Homologene: 38481
Birc7
Name: baculoviral IAP repeat-containing 7
Synonyms: ML-IAP, Livin, KIAP
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 329581
Homologene: 51405
Arhgap25
Name: Rho GTPase activating protein 25
Synonyms: A130039I20Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232201
Homologene: 45507
Zhx3
Name: zinc fingers and homeoboxes 3
Synonyms: 4932418O04Rik, 1810059C13Rik, 9530010N21Rik, Tix1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 320799
Homologene: 9000
Or8g17
Name: olfactory receptor family 8 subfamily G member 17
Synonyms: M15, MOR171-10, GA_x6K02T2PVTD-32715386-32714466, Olfr146
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258742
VEGA: 9
Or51t4
Name: olfactory receptor family 51 subfamily T member 4
Synonyms: GA_x6K02T2PBJ9-5659738-5660748, MOR14-9, Olfr574
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258357
Homologene: 27137
Sh2d4b
Name: SH2 domain containing 4B
Synonyms: A430109M18Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 328381
Homologene: 19164
Krt9
Name: keratin 9
Synonyms: K9, Krt1-9
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 107656
HGNC: HGNC:6447
Homologene: 138337
Rcor2
Name: REST corepressor 2
Synonyms: CoREST, 1A13
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 104383
Homologene: 14280
Prm3
Name: protamine 3
Synonyms: Pxg, PX, Pxg
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 19120
Homologene: 74292
Or52e19b
Name: olfactory receptor family 52 subfamily E member 19B
Synonyms: GA_x6K02T2PBJ9-6096387-6095449, GA_x6K02T2PBJ9-6092550-6092362, MOR32-2, MOR32-14_i, Olfr604, Olfr603
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259073
Homologene: 121535
Ciao2a
Name: cytosolic iron-sulfur assembly component 2A
Synonyms: 5730536A07Rik, Fam96a
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 68250
Homologene: 12252
Casp14
Name: caspase 14
Synonyms: mini-ICE, MICE
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 12365
VEGA: 10
HGNC: HGNC:1502
Homologene: 36304
Gm9611
Name: predicted gene 9611
Type: Gene
Species: Mouse
Chromosome: 14
Krtap13-20
Name: keratin associated protein 13-20
Synonyms: 2310034C09Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 117172
Homologene: 114409
Ifit3
Name: interferon-induced protein with tetratricopeptide repeats 3
Synonyms: Ifi49
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 15959
HGNC: HGNC:5411
Homologene: 1189
Dnajb4
Name: DnaJ heat shock protein family (Hsp40) member B4
Synonyms: 2010306G19Rik, 1700029A20Rik, 5730460G06Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 67035
Homologene: 100610
Scgb1b10
Name: secretoglobin, family 1B, member 10
Synonyms: Gm4384, Abpa10
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 102635992
Homologene: 114479
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 6,248,562 bp
  • G to A, chromosome 2 at 5,876,983 bp
  • A to T, chromosome 2 at 76,943,352 bp
  • A to T, chromosome 2 at 93,844,257 bp
  • A to G, chromosome 2 at 119,647,135 bp
  • G to A, chromosome 2 at 122,092,322 bp
  • A to G, chromosome 2 at 160,781,095 bp
  • G to T, chromosome 2 at 180,933,310 bp
  • A to T, chromosome 3 at 58,621,278 bp
  • T to G, chromosome 3 at 95,474,526 bp
  • A to T, chromosome 3 at 152,186,831 bp
  • A to G, chromosome 3 at 152,747,767 bp
  • A to C, chromosome 4 at 24,505,373 bp
  • C to A, chromosome 4 at 64,017,343 bp
  • T to C, chromosome 4 at 123,401,407 bp
  • A to T, chromosome 5 at 54,118,329 bp
  • G to A, chromosome 5 at 62,814,310 bp
  • A to G, chromosome 5 at 92,392,500 bp
  • A to G, chromosome 5 at 108,705,276 bp
  • T to C, chromosome 5 at 123,781,888 bp
  • G to A, chromosome 6 at 11,933,307 bp
  • G to T, chromosome 6 at 48,024,711 bp
  • A to T, chromosome 6 at 56,723,541 bp
  • G to A, chromosome 6 at 70,588,753 bp
  • T to C, chromosome 6 at 87,463,087 bp
  • A to G, chromosome 6 at 118,174,344 bp
  • A to G, chromosome 6 at 124,517,379 bp
  • A to G, chromosome 7 at 3,719,858 bp
  • T to C, chromosome 7 at 28,104,170 bp
  • A to T, chromosome 7 at 32,101,145 bp
  • A to G, chromosome 7 at 46,105,462 bp
  • A to G, chromosome 7 at 97,499,585 bp
  • A to G, chromosome 7 at 102,949,071 bp
  • A to T, chromosome 7 at 103,383,528 bp
  • T to C, chromosome 7 at 113,287,146 bp
  • T to C, chromosome 8 at 3,432,775 bp
  • A to T, chromosome 8 at 13,003,529 bp
  • C to T, chromosome 8 at 13,248,682 bp
  • T to C, chromosome 8 at 70,499,212 bp
  • A to G, chromosome 9 at 20,499,252 bp
  • T to A, chromosome 9 at 35,217,943 bp
  • A to G, chromosome 9 at 39,019,451 bp
  • A to G, chromosome 9 at 66,138,402 bp
  • A to T, chromosome 10 at 61,106,342 bp
  • C to T, chromosome 10 at 78,590,082 bp
  • T to A, chromosome 10 at 78,714,245 bp
  • A to C, chromosome 10 at 86,846,033 bp
  • A to G, chromosome 11 at 4,889,145 bp
  • G to A, chromosome 11 at 51,586,581 bp
  • T to A, chromosome 11 at 55,287,734 bp
  • A to G, chromosome 11 at 94,457,175 bp
  • TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC to TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC, chromosome 11 at 100,189,077 bp
  • G to A, chromosome 11 at 105,973,054 bp
  • T to C, chromosome 11 at 108,923,703 bp
  • A to T, chromosome 11 at 120,094,235 bp
  • A to T, chromosome 13 at 14,636,862 bp
  • C to T, chromosome 14 at 34,268,479 bp
  • A to C, chromosome 14 at 40,820,766 bp
  • G to A, chromosome 14 at 42,296,130 bp
  • A to T, chromosome 14 at 55,887,602 bp
  • A to T, chromosome 15 at 101,816,334 bp
  • CTCTTCTTCTTCTTC to CTCTTCTTCTTC, chromosome 16 at 10,790,701 bp
  • T to A, chromosome 16 at 26,516,745 bp
  • A to G, chromosome 16 at 88,759,050 bp
  • T to A, chromosome 17 at 12,652,423 bp
  • T to C, chromosome 17 at 33,883,875 bp
  • G to T, chromosome 18 at 84,015,657 bp
  • A to G, chromosome 19 at 7,273,860 bp
  • G to T, chromosome 19 at 34,587,959 bp
  • C to G, chromosome 19 at 41,610,808 bp
  • A to T, chromosome 19 at 41,610,809 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7947 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045992-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.