Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7947Btlr/Mmmh
Stock Number:
045992-MU
Citation ID:
RRID:MMRRC_045992-MU
Other Names:
R7947 (G1)
Major Collection:

Strain Information

Cacna1g
Name: calcium channel, voltage-dependent, T type, alpha 1G subunit
Synonyms: a1G, Cav3.1d
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12291
HGNC: HGNC:1394
Homologene: 22544
Slit1
Name: slit guidance ligand 1
Synonyms: Slil1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20562
Homologene: 2302
Macf1
Name: microtubule-actin crosslinking factor 1
Synonyms: Acf7, Aclp7, trabeculin alpha
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11426
Homologene: 136191
Phf14
Name: PHD finger protein 14
Synonyms: 1110001C23Rik, 4932409F11Rik, 5730446A07Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 75725
Homologene: 8775
Sgpl1
Name: sphingosine phosphate lyase 1
Synonyms: D10Xrf456
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 20397
Homologene: 2897
Arhgef18
Name: Rho/Rac guanine nucleotide exchange factor 18
Synonyms: D030053O22Rik, A430078G23Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 102098
Homologene: 32254
Abcc8
Name: ATP-binding cassette, sub-family C member 8
Synonyms: SUR1, Sur, D930031B21Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20927
HGNC: HGNC:59
Homologene: 68048
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 6,248,562 bp
  • G to A, chromosome 2 at 5,876,983 bp
  • A to T, chromosome 2 at 76,943,352 bp
  • A to T, chromosome 2 at 93,844,257 bp
  • A to G, chromosome 2 at 119,647,135 bp
  • G to A, chromosome 2 at 122,092,322 bp
  • A to G, chromosome 2 at 160,781,095 bp
  • G to T, chromosome 2 at 180,933,310 bp
  • A to T, chromosome 3 at 58,621,278 bp
  • T to G, chromosome 3 at 95,474,526 bp
  • A to T, chromosome 3 at 152,186,831 bp
  • A to G, chromosome 3 at 152,747,767 bp
  • A to C, chromosome 4 at 24,505,373 bp
  • C to A, chromosome 4 at 64,017,343 bp
  • T to C, chromosome 4 at 123,401,407 bp
  • A to T, chromosome 5 at 54,118,329 bp
  • G to A, chromosome 5 at 62,814,310 bp
  • A to G, chromosome 5 at 92,392,500 bp
  • A to G, chromosome 5 at 108,705,276 bp
  • T to C, chromosome 5 at 123,781,888 bp
  • G to A, chromosome 6 at 11,933,307 bp
  • G to T, chromosome 6 at 48,024,711 bp
  • A to T, chromosome 6 at 56,723,541 bp
  • G to A, chromosome 6 at 70,588,753 bp
  • T to C, chromosome 6 at 87,463,087 bp
  • A to G, chromosome 6 at 118,174,344 bp
  • A to G, chromosome 6 at 124,517,379 bp
  • A to G, chromosome 7 at 3,719,858 bp
  • T to C, chromosome 7 at 28,104,170 bp
  • A to T, chromosome 7 at 32,101,145 bp
  • A to G, chromosome 7 at 46,105,462 bp
  • A to G, chromosome 7 at 97,499,585 bp
  • A to G, chromosome 7 at 102,949,071 bp
  • A to T, chromosome 7 at 103,383,528 bp
  • T to C, chromosome 7 at 113,287,146 bp
  • T to C, chromosome 8 at 3,432,775 bp
  • A to T, chromosome 8 at 13,003,529 bp
  • C to T, chromosome 8 at 13,248,682 bp
  • T to C, chromosome 8 at 70,499,212 bp
  • A to G, chromosome 9 at 20,499,252 bp
  • T to A, chromosome 9 at 35,217,943 bp
  • A to G, chromosome 9 at 39,019,451 bp
  • A to G, chromosome 9 at 66,138,402 bp
  • A to T, chromosome 10 at 61,106,342 bp
  • C to T, chromosome 10 at 78,590,082 bp
  • T to A, chromosome 10 at 78,714,245 bp
  • A to C, chromosome 10 at 86,846,033 bp
  • A to G, chromosome 11 at 4,889,145 bp
  • G to A, chromosome 11 at 51,586,581 bp
  • T to A, chromosome 11 at 55,287,734 bp
  • A to G, chromosome 11 at 94,457,175 bp
  • TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC to TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC, chromosome 11 at 100,189,077 bp
  • G to A, chromosome 11 at 105,973,054 bp
  • T to C, chromosome 11 at 108,923,703 bp
  • A to T, chromosome 11 at 120,094,235 bp
  • A to T, chromosome 13 at 14,636,862 bp
  • C to T, chromosome 14 at 34,268,479 bp
  • A to C, chromosome 14 at 40,820,766 bp
  • G to A, chromosome 14 at 42,296,130 bp
  • A to T, chromosome 14 at 55,887,602 bp
  • A to T, chromosome 15 at 101,816,334 bp
  • CTCTTCTTCTTCTTC to CTCTTCTTCTTC, chromosome 16 at 10,790,701 bp
  • T to A, chromosome 16 at 26,516,745 bp
  • A to G, chromosome 16 at 88,759,050 bp
  • T to A, chromosome 17 at 12,652,423 bp
  • T to C, chromosome 17 at 33,883,875 bp
  • G to T, chromosome 18 at 84,015,657 bp
  • A to G, chromosome 19 at 7,273,860 bp
  • G to T, chromosome 19 at 34,587,959 bp
  • C to G, chromosome 19 at 41,610,808 bp
  • A to T, chromosome 19 at 41,610,809 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7947 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045992-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.