Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7952Btlr/Mmmh
Stock Number:
045996-MU
Citation ID:
RRID:MMRRC_045996-MU
Other Names:
R7952 (G1)
Major Collection:

Strain Information

Notch2
Name: notch 2
Synonyms: Motch B, N2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18129
HGNC: HGNC:7882
Homologene: 7865
Dop1b
Name: DOP1 leucine zipper like protein B
Synonyms: 0610038M01Rik, 2610510B01Rik, Dopey2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 70028
VEGA: 16
HGNC: HGNC:1291
Homologene: 21068
Tpx2
Name: TPX2, microtubule-associated
Synonyms: REPP86, DIL2, p100, 2610005B21Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 72119
HGNC: HGNC:1249
Homologene: 8107
Tcf7l2
Name: transcription factor 7 like 2, T cell specific, HMG box
Synonyms: TCF4E, TCF4B, mTcf-4E, mTcf-4B, Tcf-4, Tcf4
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 21416
Homologene: 7564
Acbd3
Name: acyl-Coenzyme A binding domain containing 3
Synonyms: Pap7, 8430407O11Rik, Gocap1, D1Ertd10e
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 170760
Homologene: 11227
Tanc2
Name: tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2
Synonyms: 5730590C14Rik, 3526402J09Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 77097
Homologene: 64680
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 3,670,619 bp
  • T to C, chromosome 1 at 75,478,942 bp
  • A to G, chromosome 1 at 134,203,286 bp
  • A to T, chromosome 1 at 135,963,955 bp
  • T to C, chromosome 1 at 180,752,338 bp
  • C to T, chromosome 2 at 66,097,842 bp
  • C to A, chromosome 2 at 91,162,541 bp
  • G to A, chromosome 2 at 104,945,456 bp
  • C to T, chromosome 2 at 152,893,594 bp
  • T to G, chromosome 3 at 38,891,721 bp
  • T to A, chromosome 3 at 41,748,661 bp
  • A to G, chromosome 3 at 88,098,370 bp
  • T to C, chromosome 3 at 98,100,236 bp
  • C to T, chromosome 3 at 129,739,996 bp
  • C to T, chromosome 4 at 125,704,547 bp
  • T to C, chromosome 4 at 137,421,908 bp
  • G to T, chromosome 4 at 155,577,067 bp
  • T to C, chromosome 5 at 94,447,043 bp
  • A to T, chromosome 5 at 123,178,264 bp
  • G to T, chromosome 5 at 145,195,898 bp
  • A to G, chromosome 6 at 48,487,329 bp
  • A to G, chromosome 7 at 6,424,850 bp
  • A to G, chromosome 7 at 34,675,494 bp
  • A to T, chromosome 7 at 45,336,268 bp
  • A to G, chromosome 7 at 102,984,514 bp
  • G to T, chromosome 7 at 123,286,691 bp
  • T to C, chromosome 7 at 133,748,996 bp
  • A to T, chromosome 8 at 71,658,487 bp
  • G to A, chromosome 8 at 84,689,340 bp
  • G to T, chromosome 8 at 104,330,571 bp
  • GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA to GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA, chromosome 8 at 109,624,195 bp
  • A to G, chromosome 9 at 7,129,802 bp
  • T to G, chromosome 10 at 39,030,490 bp
  • T to C, chromosome 10 at 49,422,537 bp
  • G to T, chromosome 11 at 105,896,597 bp
  • T to C, chromosome 13 at 11,646,427 bp
  • T to A, chromosome 13 at 19,349,570 bp
  • A to G, chromosome 13 at 34,046,797 bp
  • C to T, chromosome 13 at 40,280,305 bp
  • C to A, chromosome 13 at 41,316,955 bp
  • TTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAG to TTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAG, chromosome 13 at 93,097,004 bp
  • T to C, chromosome 14 at 55,625,303 bp
  • A to G, chromosome 14 at 64,075,683 bp
  • T to C, chromosome 15 at 4,951,211 bp
  • C to T, chromosome 15 at 98,850,768 bp
  • A to G, chromosome 15 at 99,322,637 bp
  • C to T, chromosome 16 at 78,334,235 bp
  • C to A, chromosome 16 at 93,749,960 bp
  • T to A, chromosome 17 at 20,502,327 bp
  • T to C, chromosome 17 at 37,672,817 bp
  • A to T, chromosome 17 at 52,959,465 bp
  • A to G, chromosome 19 at 44,520,540 bp
  • A to T, chromosome 19 at 55,898,557 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7952 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045996-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.