Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7952Btlr/Mmmh
Stock Number:
045996-MU
Citation ID:
RRID:MMRRC_045996-MU
Other Names:
R7952 (G1)
Major Collection:

Strain Information

Notch2
Name: notch 2
Synonyms: Motch B, N2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18129
HGNC: HGNC:7882
Homologene: 7865
Dop1b
Name: DOP1 leucine zipper like protein B
Synonyms: 0610038M01Rik, 2610510B01Rik, Dopey2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 70028
VEGA: 16
HGNC: HGNC:1291
Homologene: 21068
Tpx2
Name: TPX2, microtubule-associated
Synonyms: REPP86, DIL2, p100, 2610005B21Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 72119
HGNC: HGNC:1249
Homologene: 8107
Tcf7l2
Name: transcription factor 7 like 2, T cell specific, HMG box
Synonyms: TCF4E, TCF4B, mTcf-4E, mTcf-4B, Tcf-4, Tcf4
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 21416
Homologene: 7564
Acbd3
Name: acyl-Coenzyme A binding domain containing 3
Synonyms: Pap7, 8430407O11Rik, Gocap1, D1Ertd10e
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 170760
Homologene: 11227
Tanc2
Name: tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2
Synonyms: 5730590C14Rik, 3526402J09Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 77097
Homologene: 64680
Ryr2
Name: ryanodine receptor 2, cardiac
Synonyms: 9330127I20Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20191
VEGA: 13
Homologene: 37423
Iqgap3
Name: IQ motif containing GTPase activating protein 3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 404710
Homologene: 26400
Arhgap17
Name: Rho GTPase activating protein 17
Synonyms: WBP15, Nadrin, Rich1, 5730403H17Rik, Nadrin2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 70497
Homologene: 9984
Dhx32
Name: DEAH-box helicase 32 (putative)
Synonyms: Ddx32, DEAH (Asp-Glu-Ala-His) box polypeptide 32
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101437
Homologene: 56798
Smim17
Name: small integral membrane protein 17
Synonyms: Gm16532
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100042450
Homologene: 104897
Chpf
Name: chondroitin polymerizing factor
Synonyms: 1700028N03Rik, D1Bwg1363e
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74241
Homologene: 11574
Dync2h1
Name: dynein cytoplasmic 2 heavy chain 1
Synonyms: DHC1b, DHC2, 4432416O06Rik, D330044F14Rik, D030010H02Rik, Dnchc2, b2b414Clo, m407Asp, m152Asp
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 110350
HGNC: HGNC:2962
Homologene: 14468
Trmt1
Name: tRNA methyltransferase 1
Synonyms: 6720406L13Rik, D8Ertd812e
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 212528
Homologene: 5632
Nadk
Name: NAD kinase
Synonyms: 4432404C02Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 192185
Homologene: 49724
Galnt3
Name: polypeptide N-acetylgalactosaminyltransferase 3
Synonyms: ppGaNTase-T3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14425
HGNC: HGNC:4125
Homologene: 55827
Rec8
Name: REC8 meiotic recombination protein
Synonyms: mrec, Rec8L1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 56739
Homologene: 3768
Sec31b
Name: SEC31 homolog B, COPII coat complex component
Synonyms: LOC240667, Sec31l2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 240667
Homologene: 56708
Cmya5
Name: cardiomyopathy associated 5
Synonyms: Myospryn, 2310076E16Rik, 2310076E21Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 76469
VEGA: 13
Homologene: 137367
Lama4
Name: laminin, alpha 4
Synonyms: laminin [a]4
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16775
HGNC: HGNC:6484
Homologene: 37604
Fmnl3
Name: formin-like 3
Synonyms: 2700073B04Rik, Wbp3
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 22379
Homologene: 69101
Ccdc73
Name: coiled-coil domain containing 73
Synonyms: 2210415I11Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 211936
Homologene: 52235
Fat4
Name: FAT atypical cadherin 4
Synonyms: 6030410K14Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 329628
Homologene: 14377
Hrc
Name: histidine rich calcium binding protein
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 15464
HGNC: HGNC:5178
Homologene: 137234
Mroh2b
Name: maestro heat-like repeat family member 2B
Synonyms: 4930455B06Rik, Heatr7b2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223825
VEGA: 15
Homologene: 128807
Or10al2
Name: olfactory receptor family 10 subfamily AL member 2
Synonyms: GA_x6K02T2PSCP-2131124-2132089, MOR263-13, Olfr118
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 404308
Homologene: 110622
Grik3
Name: glutamate receptor, ionotropic, kainate 3
Synonyms: Glur-7, Glur7
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 14807
HGNC: HGNC:4581
Homologene: 73901
Unc13a
Name: unc-13 homolog A
Synonyms: Munc13-1, 2410078G03Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 382018
Homologene: 11279
Hpd
Name: 4-hydroxyphenylpyruvic acid dioxygenase
Synonyms: Hppd, Laf, Flp, Fla
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 15445
HGNC: HGNC:5147
Homologene: 1620
Sspo
Name: SCO-spondin
Synonyms: C79529, Scospondin
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243369
Homologene: 45453
Kmt2d
Name: lysine (K)-specific methyltransferase 2D
Synonyms: C430014K11Rik, Mll4, Mll2, bapa
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 381022
HGNC: HGNC:7133
Homologene: 86893
Ofcc1
Name: orofacial cleft 1 candidate 1
Synonyms: ojoplano, Opo
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218165
VEGA: 13
Homologene: 125376
Bphl
Name: biphenyl hydrolase like
Synonyms: 2010012D11Rik, 5730533B08Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 68021
VEGA: 13
HGNC: HGNC:1094
Homologene: 55812
Igfn1
Name: immunoglobulin-like and fibronectin type III domain containing 1
Synonyms: 9830123M21Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226438
Homologene: 130054
Xkr4
Name: X-linked Kx blood group related 4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 497097
Homologene: 45848
D3Ertd751e
Name: DNA segment, Chr 3, ERATO Doi 751, expressed
Synonyms: 4930415G15Rik, 2810009O15Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 73852
Homologene: 12520
Cmtm2b
Name: CKLF-like MARVEL transmembrane domain containing 2B
Synonyms: 1700013O04Rik, Cklfsf2b
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 75502
Homologene: 88915
Prss55
Name: serine protease 55
Synonyms: 4933401F05Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 71037
Homologene: 51233
Kcnh8
Name: potassium voltage-gated channel, subfamily H (eag-related), member 8
Synonyms: Kv12.1, ELK1, C130090D05Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 211468
Homologene: 14332
Chst8
Name: carbohydrate sulfotransferase 8
Synonyms: 1500011J21Rik, GalNAc4ST-1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 68947
Homologene: 41483
Cxadr
Name: coxsackie virus and adenovirus receptor
Synonyms: MCAR, 2610206D03Rik, CAR, MCVADR
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 13052
HGNC: HGNC:2559
Homologene: 1024
Grik2
Name: glutamate receptor, ionotropic, kainate 2 (beta 2)
Synonyms: Glur-6, Glur6, Glurbeta2, C130030K03Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 14806
HGNC: HGNC:4580
Homologene: 40717
Vmn1r225
Name: vomeronasal 1 receptor 225
Synonyms: V1re5
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 171228
Cela3b
Name: chymotrypsin-like elastase family, member 3B
Synonyms: 2310074F01Rik, 0910001F22Rik, Ela3, Ela3b
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 67868
Homologene: 128227
Or51g1
Name: olfactory receptor family 51 subfamily G member 1
Synonyms: GA_x6K02T2PBJ9-5696486-5695545, MOR7-1, Olfr578
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259119
Homologene: 17513
Nedd9
Name: neural precursor cell expressed, developmentally down-regulated gene 9
Synonyms: E230025G09Rik, CasL, HEF1, Cas-L
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 18003
VEGA: 13
HGNC: HGNC:7733
Homologene: 4669
Zkscan14
Name: zinc finger with KRAB and SCAN domains 14
Synonyms: 2810437E14Rik, 2310046C23Rik, Zfp99
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 67235
Homologene: 11342
Adora1
Name: adenosine A1 receptor
Synonyms: A1AR, A1R, A1-AR, Ri, AA1R, ARA1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 11539
HGNC: HGNC:262
Homologene: 20165
Trgc4
Name: T cell receptor gamma, constant 4
Synonyms: Tcrg-C4
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 107576
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 3,670,619 bp
  • T to C, chromosome 1 at 75,478,942 bp
  • A to G, chromosome 1 at 134,203,286 bp
  • A to T, chromosome 1 at 135,963,955 bp
  • T to C, chromosome 1 at 180,752,338 bp
  • C to T, chromosome 2 at 66,097,842 bp
  • C to A, chromosome 2 at 91,162,541 bp
  • G to A, chromosome 2 at 104,945,456 bp
  • C to T, chromosome 2 at 152,893,594 bp
  • T to G, chromosome 3 at 38,891,721 bp
  • T to A, chromosome 3 at 41,748,661 bp
  • A to G, chromosome 3 at 88,098,370 bp
  • T to C, chromosome 3 at 98,100,236 bp
  • C to T, chromosome 3 at 129,739,996 bp
  • C to T, chromosome 4 at 125,704,547 bp
  • T to C, chromosome 4 at 137,421,908 bp
  • G to T, chromosome 4 at 155,577,067 bp
  • T to C, chromosome 5 at 94,447,043 bp
  • A to T, chromosome 5 at 123,178,264 bp
  • G to T, chromosome 5 at 145,195,898 bp
  • A to G, chromosome 6 at 48,487,329 bp
  • A to G, chromosome 7 at 6,424,850 bp
  • A to G, chromosome 7 at 34,675,494 bp
  • A to T, chromosome 7 at 45,336,268 bp
  • A to G, chromosome 7 at 102,984,514 bp
  • G to T, chromosome 7 at 123,286,691 bp
  • T to C, chromosome 7 at 133,748,996 bp
  • A to T, chromosome 8 at 71,658,487 bp
  • G to A, chromosome 8 at 84,689,340 bp
  • G to T, chromosome 8 at 104,330,571 bp
  • GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA to GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA, chromosome 8 at 109,624,195 bp
  • A to G, chromosome 9 at 7,129,802 bp
  • T to G, chromosome 10 at 39,030,490 bp
  • T to C, chromosome 10 at 49,422,537 bp
  • G to T, chromosome 11 at 105,896,597 bp
  • T to C, chromosome 13 at 11,646,427 bp
  • T to A, chromosome 13 at 19,349,570 bp
  • A to G, chromosome 13 at 34,046,797 bp
  • C to T, chromosome 13 at 40,280,305 bp
  • C to A, chromosome 13 at 41,316,955 bp
  • TTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAG to TTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAGGCGCATGCTCCTCCTCTCTGTGGACTATGGGCTCAG, chromosome 13 at 93,097,004 bp
  • T to C, chromosome 14 at 55,625,303 bp
  • A to G, chromosome 14 at 64,075,683 bp
  • T to C, chromosome 15 at 4,951,211 bp
  • C to T, chromosome 15 at 98,850,768 bp
  • A to G, chromosome 15 at 99,322,637 bp
  • C to T, chromosome 16 at 78,334,235 bp
  • C to A, chromosome 16 at 93,749,960 bp
  • T to A, chromosome 17 at 20,502,327 bp
  • T to C, chromosome 17 at 37,672,817 bp
  • A to T, chromosome 17 at 52,959,465 bp
  • A to G, chromosome 19 at 44,520,540 bp
  • A to T, chromosome 19 at 55,898,557 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7952 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
045996-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.