Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7963Btlr/Mmmh
Stock Number:
046006-MU
Citation ID:
RRID:MMRRC_046006-MU
Other Names:
R7963 (G1)
Major Collection:

Strain Information

Ncor1
Name: nuclear receptor co-repressor 1
Synonyms: N-CoR, Rxrip13, A230020K14Rik, 5730405M06Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20185
HGNC: HGNC:7672
Homologene: 38166
Dlg1
Name: discs large MAGUK scaffold protein 1
Synonyms: B130052P05Rik, SAP97, Dlgh1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 13383
HGNC: HGNC:2900
Homologene: 20869
Fgf1
Name: fibroblast growth factor 1
Synonyms: fibroblast growth factor 1 (acidic), Fgf-1, Fgfa
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 14164
HGNC: HGNC:3665
Homologene: 625
Ptp4a2
Name: protein tyrosine phosphatase 4a2
Synonyms: Prl-2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 19244
HGNC: HGNC:9635
Homologene: 20744
Pdxdc1
Name: pyridoxal-dependent decarboxylase domain containing 1
Synonyms: 2210010A19Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 94184
Homologene: 22858
F2rl3
Name: F2R like thrombin or trypsin receptor 3
Synonyms: PAR4
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 14065
HGNC: HGNC:3540
Homologene: 36148
Garem1
Name: GRB2 associated regulator of MAPK1 subtype 1
Synonyms: LOC381126, Fam59a, Garem
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 381126
VEGA: 18
Homologene: 11237
Pcx
Name: pyruvate carboxylase
Synonyms: Pc
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18563
VEGA: 19
HGNC: HGNC:8636
Homologene: 5422
Il2ra
Name: interleukin 2 receptor, alpha chain
Synonyms: IL-2R alpha chain, CD25, Ly-43, Il2r
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16184
HGNC: HGNC:6008
Homologene: 360
Dnajc1
Name: DnaJ heat shock protein family (Hsp40) member C1
Synonyms: MTJ1, Dnajl1, ERdj1, 4733401K02Rik, D230036H06Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 13418
Homologene: 7293
Plod2
Name: procollagen lysine, 2-oxoglutarate 5-dioxygenase 2
Synonyms: lysyl hydroxylase 2, LH2, Plod-2, D530025C14Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 26432
HGNC: HGNC:9082
Homologene: 22681
Zfp597
Name: zinc finger protein 597
Synonyms: 4933407K12Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 71063
Homologene: 33641
Cdv3
Name: carnitine deficiency-associated gene expressed in ventricle 3
Synonyms: TPP36, 2510010F10Rik, C230084J24Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 321022
Homologene: 133862
Nrde2
Name: nrde-2 necessary for RNA interference, domain containing
Synonyms: 6720454P05Rik, BC002230
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217827
VEGA: 12
Homologene: 41213
Ssh2
Name: slingshot protein phosphatase 2
Synonyms: SSH-2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237860
Homologene: 14116
Cep295
Name: centrosomal protein 295
Synonyms: LOC382128, 5830418K08Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 319675
Homologene: 27936
Nfkb2
Name: nuclear factor of kappa light polypeptide gene enhancer in B cells 2, p49/p100
Synonyms: p52, NF kappaB2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18034
VEGA: 19
HGNC: HGNC:7795
Homologene: 1873
Lrp3
Name: low density lipoprotein receptor-related protein 3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 435965
HGNC: HGNC:6695
Homologene: 1745
Peg10
Name: paternally expressed 10
Synonyms: MEF3L, HB-1, MyEF-3, MyEF-3 like, Edr, Mart2, Mar2, Rtl2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 170676
Homologene: 116067
Cdh23
Name: cadherin related 23 (otocadherin)
Synonyms: 4930542A03Rik, USH1D, mdfw, ahl, nmf252, bob, nmf112, nmf181, sals
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 22295
Homologene: 11142
Syne2
Name: spectrin repeat containing, nuclear envelope 2
Synonyms: nesprin-2, syne-2, D12Ertd777e, 6820443O06Rik, Nesp2g, Cpfl8, diminished cone electroretinogram, dice
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 319565
Homologene: 56700
Ncoa6
Name: nuclear receptor coactivator 6
Synonyms: PRIP, ASC2, RAP250, AIB3, NRC, ASC-2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 56406
Homologene: 137337
Stab2
Name: stabilin 2
Synonyms: STAB-2, FEEL-2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 192188
Homologene: 23022
Lrp1b
Name: low density lipoprotein-related protein 1B
Synonyms: 9630004P12Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 94217
HGNC: HGNC:6693
Homologene: 56810
Or8k33
Name: olfactory receptor family 8 subfamily K member 33
Synonyms: GA_x6K02T2Q125-48039418-48038477, MOR192-1, Olfr1080
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258404
Homologene: 104285
Arhgef10l
Name: Rho guanine nucleotide exchange factor 10-like
Synonyms: 2810441C07Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 72754
Homologene: 10017
4930407I10Rik
Name: RIKEN cDNA 4930407I10 gene
Synonyms: LOC328573
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 328573
VEGA: 15
Homologene: 130065
Dnaaf11
Name: dynein axonemal assembly factor 11
Synonyms: LRTP, Lrrc6
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 54562
Homologene: 34534
Rsl1
Name: regulator of sex limited protein 1
Synonyms: rslcan-9
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 380855
Homologene: 110878
Spag17
Name: sperm associated antigen 17
Synonyms: 4931427F14Rik, PF6
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 74362
Homologene: 52601
Atp9a
Name: ATPase, class II, type 9A
Synonyms: Class II, IIa
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11981
Homologene: 69194
Slc28a3
Name: solute carrier family 28 (sodium-coupled nucleoside transporter), member 3
Synonyms: Cnt3
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 114304
Homologene: 32533
Or4c52
Name: olfactory receptor family 4 subfamily C member 52
Synonyms: GA_x6K02T2Q125-51447049-51447969, MOR234-2, Olfr1263
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258790
Homologene: 45043
Or4k41
Name: olfactory receptor family 4 subfamily K member 41
Synonyms: GA_x6K02T2Q125-72500603-72501520, MOR248-15, Olfr1287
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 257935
Akr1b10
Name: aldo-keto reductase family 1, member B10
Synonyms: 2310005E10Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67861
Homologene: 128412
Stac2
Name: SH3 and cysteine rich domain 2
Synonyms: 24b2/STAC2, 24b2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217154
Homologene: 17131
Or5w1b
Name: olfactory receptor family 5 subfamily W member 1B
Synonyms: GA_x6K02T2Q125-49151278-49150337, MOR176-2, Olfr1133
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258348
Vmn2r38
Name: vomeronasal 2, receptor 38
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 434110
Homologene: 113703
Ctsr
Name: cathepsin R
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 56835
VEGA: 13
Homologene: 75127
Btbd18
Name: BTB domain containing 18
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 100270744
Homologene: 122125
Cmtm1
Name: CKLF-like MARVEL transmembrane domain containing 1
Synonyms: CHLFH1a, CKLFH1, Cklfsf1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 100504164
Homologene: 134399
H3c13
Name: H3 clustered histone 13
Synonyms: H3-616, Hist2h3b
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 319154
Homologene: 136775
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 2 at 11,674,424 bp
  • G to A, chromosome 2 at 18,222,724 bp
  • C to A, chromosome 2 at 29,926,100 bp
  • T to C, chromosome 2 at 40,927,935 bp
  • T to C, chromosome 2 at 84,667,895 bp
  • T to C, chromosome 2 at 86,553,295 bp
  • C to T, chromosome 2 at 87,645,425 bp
  • T to C, chromosome 2 at 90,015,659 bp
  • T to A, chromosome 2 at 111,449,626 bp
  • G to A, chromosome 2 at 155,405,996 bp
  • T to C, chromosome 2 at 168,674,812 bp
  • A to T, chromosome 2 at 168,951,618 bp
  • C to A, chromosome 3 at 96,268,993 bp
  • T to A, chromosome 3 at 100,022,638 bp
  • A to G, chromosome 4 at 129,839,444 bp
  • T to C, chromosome 4 at 140,579,425 bp
  • GC to GCTCC, chromosome 6 at 4,756,452 bp
  • G to C, chromosome 6 at 34,387,708 bp
  • A to T, chromosome 7 at 9,092,855 bp
  • G to A, chromosome 7 at 35,202,979 bp
  • T to C, chromosome 8 at 72,762,705 bp
  • CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT to CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT, chromosome 8 at 104,309,470 bp
  • A to G, chromosome 9 at 15,333,441 bp
  • A to G, chromosome 9 at 92,605,446 bp
  • T to C, chromosome 9 at 103,364,011 bp
  • A to T, chromosome 10 at 60,336,188 bp
  • A to G, chromosome 10 at 86,848,023 bp
  • T to C, chromosome 11 at 62,334,533 bp
  • C to A, chromosome 11 at 77,421,356 bp
  • T to C, chromosome 11 at 98,041,577 bp
  • T to A, chromosome 12 at 76,020,400 bp
  • T to C, chromosome 12 at 100,149,868 bp
  • A to G, chromosome 13 at 58,576,766 bp
  • C to A, chromosome 13 at 61,162,462 bp
  • A to G, chromosome 13 at 67,182,109 bp
  • A to G, chromosome 13 at 77,192,554 bp
  • A to T, chromosome 15 at 66,380,517 bp
  • A to G, chromosome 15 at 82,063,936 bp
  • T to C, chromosome 16 at 3,871,158 bp
  • A to T, chromosome 16 at 13,876,166 bp
  • G to A, chromosome 16 at 31,790,301 bp
  • T to C, chromosome 18 at 21,148,787 bp
  • A to T, chromosome 18 at 38,847,114 bp
  • T to C, chromosome 19 at 4,602,006 bp
  • C to T, chromosome 19 at 46,309,919 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7963 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
046006-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.