Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7972Btlr/Mmmh
Stock Number:
046015-MU
Citation ID:
RRID:MMRRC_046015-MU
Other Names:
R7972 (G1)
Major Collection:

Strain Information

Evl
Name: Ena-vasodilator stimulated phosphoprotein
Synonyms: b2b2600Clo
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 14026
VEGA: 12
Homologene: 56752
Ppp4r1
Name: protein phosphatase 4, regulatory subunit 1
Synonyms: Pp4r1, 3110001J10Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 70351
HGNC: HGNC:9320
Homologene: 81737
Triobp
Name: TRIO and F-actin binding protein
Synonyms: Mus EST 478828, Tara, EST478828
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 110253
Homologene: 5104
Gstcd
Name: glutathione S-transferase, C-terminal domain containing
Synonyms: 4933434L15Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 67553
Homologene: 11693
Rps6kc1
Name: ribosomal protein S6 kinase polypeptide 1
Synonyms: RPK118, B130003F20Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 320119
Homologene: 8244
Fry
Name: FRY microtubule binding protein
Synonyms: cg003, 9330186A19Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 320365
Homologene: 113770
Chd9
Name: chromodomain helicase DNA binding protein 9
Synonyms: 1810014J18Rik, AD013, A330063D19Rik, 9030205D12Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 109151
Homologene: 11844
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 39,392,169 bp
  • T to A, chromosome 1 at 165,236,974 bp
  • T to A, chromosome 1 at 166,099,139 bp
  • T to A, chromosome 1 at 173,678,990 bp
  • C to T, chromosome 1 at 190,799,124 bp
  • G to T, chromosome 2 at 74,675,925 bp
  • A to T, chromosome 2 at 75,980,458 bp
  • T to A, chromosome 2 at 88,958,833 bp
  • T to G, chromosome 2 at 89,527,604 bp
  • G to A, chromosome 2 at 120,278,932 bp
  • A to G, chromosome 3 at 5,412,473 bp
  • G to A, chromosome 3 at 110,135,486 bp
  • A to T, chromosome 3 at 133,072,133 bp
  • T to A, chromosome 4 at 96,297,634 bp
  • T to C, chromosome 4 at 120,097,514 bp
  • T to C, chromosome 4 at 125,119,935 bp
  • G to A, chromosome 4 at 134,006,263 bp
  • G to T, chromosome 5 at 24,419,658 bp
  • A to G, chromosome 5 at 65,223,850 bp
  • A to T, chromosome 5 at 107,348,549 bp
  • AGG to AG, chromosome 5 at 114,015,209 bp
  • C to T, chromosome 5 at 114,226,857 bp
  • T to C, chromosome 5 at 124,726,885 bp
  • T to C, chromosome 5 at 137,801,061 bp
  • T to C, chromosome 5 at 150,310,396 bp
  • A to T, chromosome 7 at 23,984,446 bp
  • G to A, chromosome 7 at 30,414,638 bp
  • T to C, chromosome 7 at 30,511,155 bp
  • A to T, chromosome 8 at 91,005,767 bp
  • G to A, chromosome 8 at 105,951,605 bp
  • C to A, chromosome 9 at 18,645,764 bp
  • T to A, chromosome 9 at 89,091,308 bp
  • C to T, chromosome 9 at 102,723,769 bp
  • G to A, chromosome 10 at 52,154,830 bp
  • A to T, chromosome 10 at 53,638,259 bp
  • A to T, chromosome 10 at 79,783,396 bp
  • A to G, chromosome 11 at 58,968,568 bp
  • T to A, chromosome 11 at 70,242,687 bp
  • T to G, chromosome 11 at 100,752,452 bp
  • A to G, chromosome 11 at 120,619,190 bp
  • G to A, chromosome 12 at 17,352,647 bp
  • C to T, chromosome 12 at 30,006,602 bp
  • C to T, chromosome 12 at 108,681,524 bp
  • A to G, chromosome 13 at 21,715,807 bp
  • T to C, chromosome 14 at 75,848,099 bp
  • CAGCTGGAGGAGC to CAGC, chromosome 15 at 78,436,913 bp
  • T to C, chromosome 15 at 78,967,986 bp
  • AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG to AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG, chromosome 16 at 91,660,334 bp
  • T to A, chromosome 17 at 27,708,639 bp
  • G to A, chromosome 17 at 28,550,728 bp
  • T to A, chromosome 17 at 35,101,311 bp
  • T to A, chromosome 17 at 65,833,098 bp
  • A to G, chromosome 19 at 6,106,244 bp
  • T to C, chromosome 19 at 24,900,230 bp
  • T to A, chromosome 19 at 56,848,702 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7972 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
046015-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.