Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7972Btlr/Mmmh
Stock Number:
046015-MU
Citation ID:
RRID:MMRRC_046015-MU
Other Names:
R7972 (G1)
Major Collection:

Strain Information

Evl
Name: Ena-vasodilator stimulated phosphoprotein
Synonyms: b2b2600Clo
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 14026
VEGA: 12
Homologene: 56752
Ppp4r1
Name: protein phosphatase 4, regulatory subunit 1
Synonyms: Pp4r1, 3110001J10Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 70351
HGNC: HGNC:9320
Homologene: 81737
Triobp
Name: TRIO and F-actin binding protein
Synonyms: Mus EST 478828, Tara, EST478828
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 110253
Homologene: 5104
Gstcd
Name: glutathione S-transferase, C-terminal domain containing
Synonyms: 4933434L15Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 67553
Homologene: 11693
Rps6kc1
Name: ribosomal protein S6 kinase polypeptide 1
Synonyms: RPK118, B130003F20Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 320119
Homologene: 8244
Fry
Name: FRY microtubule binding protein
Synonyms: cg003, 9330186A19Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 320365
Homologene: 113770
Chd9
Name: chromodomain helicase DNA binding protein 9
Synonyms: 1810014J18Rik, AD013, A330063D19Rik, 9030205D12Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 109151
Homologene: 11844
Nol10
Name: nucleolar protein 10
Synonyms: LOC217431
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217431
VEGA: 12
Homologene: 5998
Tbc1d8
Name: TBC1 domain family, member 8
Synonyms: BUB2-like protein 1, HBLP1, AD3, GRAM domain
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 54610
Homologene: 31421
Kctd17
Name: potassium channel tetramerisation domain containing 17
Synonyms: 2900008M13Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 72844
Homologene: 23468
Son
Name: Son DNA binding protein
Synonyms: 2900011L12Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 20658
Homologene: 10551
Muc16
Name: mucin 16
Synonyms: LOC385009, 1110008I14Rik, Gm21044
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 73732
Homologene: 141193
Slc12a4
Name: solute carrier family 12, member 4
Synonyms: KCC1, K-Cl Co-transporter-1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 20498
Homologene: 21056
Tiprl
Name: TIP41, TOR signalling pathway regulator-like (S. cerevisiae)
Synonyms: 1810011K17Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226591
Homologene: 7140
Amotl2
Name: angiomotin-like 2
Synonyms: Lccp, MASCOT
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 56332
Homologene: 9420
Styxl2
Name: serine/threonine/tyrosine interacting like 2
Synonyms: C130085G02Rik, Dusp27
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240892
Homologene: 18949
Prss57
Name: serine protease 57
Synonyms: GLGL782, UNQ782, 2900092M14Rik, Prssl1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 73106
Homologene: 133812
Wdr19
Name: WD repeat domain 19
Synonyms: C330027H04Rik, D330023L08Rik, Ift144, DYF2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 213081
Homologene: 11842
Zfhx4
Name: zinc finger homeodomain 4
Synonyms: Zfh-4, C130041O22Rik, Zfh4
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 80892
Homologene: 23477
Dnah10
Name: dynein, axonemal, heavy chain 10
Synonyms: Dnahc10
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 56087
HGNC: HGNC:2941
Homologene: 25816
Zc3h12a
Name: zinc finger CCCH type containing 12A
Synonyms: Mcpip1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230738
Homologene: 11824
Trim17
Name: tripartite motif-containing 17
Synonyms: terf, Rnf16
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 56631
Homologene: 9387
Acacb
Name: acetyl-Coenzyme A carboxylase beta
Synonyms: Accb, Acc2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100705
HGNC: HGNC:85
Homologene: 74382
Cyp2j11
Name: cytochrome P450, family 2, subfamily j, polypeptide 11
Synonyms: Cyp2j11-ps
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100066
HGNC: HGNC:2634
Homologene: 133819
Ifi208
Name: interferon activated gene 208
Synonyms: E430029J22Rik, Pydc3, Pyr-rv1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 100033459
Homologene: 115929
Kcnh4
Name: potassium voltage-gated channel, subfamily H (eag-related), member 4
Synonyms: BEC2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380728
HGNC: HGNC:6253
Homologene: 8180
Ros1
Name: Ros1 proto-oncogene
Synonyms: Ros-1, c-ros
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19886
Homologene: 2207
Pxdn
Name: peroxidasin
Synonyms: 2310075M15Rik, VPO1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 69675
Homologene: 33907
Tdrd1
Name: tudor domain containing 1
Synonyms: MTR-1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 83561
Homologene: 12850
Naaladl1
Name: N-acetylated alpha-linked acidic dipeptidase-like 1
Synonyms: LOC381204
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 381204
Homologene: 21124
Zcwpw1
Name: zinc finger, CW type with PWWP domain 1
Synonyms: LOC381678
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 381678
Homologene: 9944
Or4a71
Name: olfactory receptor family 4 subfamily A member 71
Synonyms: GA_x6K02T2Q125-50972538-50971621, MOR231-4, Olfr1243
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258971
Homologene: 27317
Dao
Name: D-amino acid oxidase
Synonyms: DAO, Dao-1, Dao1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 13142
HGNC: HGNC:2671
Homologene: 37553
Alox12
Name: arachidonate 12-lipoxygenase
Synonyms: P-12LO, Alox12p, 9930022G08Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 11684
HGNC: HGNC:429
Homologene: 560
Vmn1r181
Name: vomeronasal 1 receptor 181
Synonyms: V1rd20
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 404289
Homologene: 104166
Or4c107
Name: olfactory receptor family 4 subfamily C member 107
Synonyms: GA_x6K02T2Q125-50437014-50437949, MOR233-20, MOR233-17, Olfr1212
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258241
Homologene: 66154
Hivep3
Name: human immunodeficiency virus type I enhancer binding protein 3
Synonyms: Krc, E030045D18Rik, 2900056N03Rik, Shn3, Schnurri-3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 16656
Homologene: 7803
Tyrobp
Name: TYRO protein tyrosine kinase binding protein
Synonyms: killer cell activating receptor associated protein, KARAP, DAP12
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22177
Homologene: 7986
Pacsin1
Name: protein kinase C and casein kinase substrate in neurons 1
Synonyms: A830061D09Rik, Syndapin I
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 23969
HGNC: HGNC:8570
Homologene: 22674
Fam184a
Name: family with sequence similarity 184, member A
Synonyms: 3110012E06Rik, 4930438C08Rik, 4930589M24Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 75906
Homologene: 11600
H2bc13
Name: H2B clustered histone 13
Synonyms: Hist1h2bl
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 319185
HGNC: HGNC:4748
Homologene: 136773
Brdt
Name: bromodomain, testis-specific
Synonyms: 7420412D09Rik, Brd6, Fsrg3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 114642
HGNC: HGNC:1105
Homologene: 21064
Lin28a
Name: lin-28 homolog A
Synonyms: Lin-28, Tex17, Lin28a, Lin28
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 83557
Homologene: 32592
Hoxd12
Name: homeobox D12
Synonyms: Hox-5.6, Hox-4.7
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 15432
HGNC: HGNC:5135
Homologene: 7369
Abhd16a
Name: abhydrolase domain containing 16A
Synonyms: Bat5, NG26, D17H6S82E
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 193742
Homologene: 10904
Ift70a1
Name: intraflagellar transport 70A1
Synonyms: 4930506L13Rik, Ttc30a1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 78802
Homologene: 136638
Prodh2
Name: proline dehydrogenase (oxidase) 2
Synonyms: MmPOX1, 2510038B11Rik, 2510028N04Rik, POX1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 56189
Homologene: 36381
Pla2g4d
Name: phospholipase A2, group IVD
Synonyms: 2610311B01Rik, Pla2delta
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 78390
Homologene: 52252
Clpsl2
Name: colipase-like 2
Synonyms: LOC328788, Gm749
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 328788
Homologene: 86835
Tpt1
Name: tumor protein, translationally-controlled 1
Synonyms: Trt, fortilin, TCTP
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 22070
Homologene: 55730
Cdk5
Name: cyclin dependent kinase 5
Synonyms: Crk6
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12568
HGNC: HGNC:1774
Homologene: 3623
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 39,392,169 bp
  • T to A, chromosome 1 at 165,236,974 bp
  • T to A, chromosome 1 at 166,099,139 bp
  • T to A, chromosome 1 at 173,678,990 bp
  • C to T, chromosome 1 at 190,799,124 bp
  • G to T, chromosome 2 at 74,675,925 bp
  • A to T, chromosome 2 at 75,980,458 bp
  • T to A, chromosome 2 at 88,958,833 bp
  • T to G, chromosome 2 at 89,527,604 bp
  • G to A, chromosome 2 at 120,278,932 bp
  • A to G, chromosome 3 at 5,412,473 bp
  • G to A, chromosome 3 at 110,135,486 bp
  • A to T, chromosome 3 at 133,072,133 bp
  • T to A, chromosome 4 at 96,297,634 bp
  • T to C, chromosome 4 at 120,097,514 bp
  • T to C, chromosome 4 at 125,119,935 bp
  • G to A, chromosome 4 at 134,006,263 bp
  • G to T, chromosome 5 at 24,419,658 bp
  • A to G, chromosome 5 at 65,223,850 bp
  • A to T, chromosome 5 at 107,348,549 bp
  • AGG to AG, chromosome 5 at 114,015,209 bp
  • C to T, chromosome 5 at 114,226,857 bp
  • T to C, chromosome 5 at 124,726,885 bp
  • T to C, chromosome 5 at 137,801,061 bp
  • T to C, chromosome 5 at 150,310,396 bp
  • A to T, chromosome 7 at 23,984,446 bp
  • G to A, chromosome 7 at 30,414,638 bp
  • T to C, chromosome 7 at 30,511,155 bp
  • A to T, chromosome 8 at 91,005,767 bp
  • G to A, chromosome 8 at 105,951,605 bp
  • C to A, chromosome 9 at 18,645,764 bp
  • T to A, chromosome 9 at 89,091,308 bp
  • C to T, chromosome 9 at 102,723,769 bp
  • G to A, chromosome 10 at 52,154,830 bp
  • A to T, chromosome 10 at 53,638,259 bp
  • A to T, chromosome 10 at 79,783,396 bp
  • A to G, chromosome 11 at 58,968,568 bp
  • T to A, chromosome 11 at 70,242,687 bp
  • T to G, chromosome 11 at 100,752,452 bp
  • A to G, chromosome 11 at 120,619,190 bp
  • G to A, chromosome 12 at 17,352,647 bp
  • C to T, chromosome 12 at 30,006,602 bp
  • C to T, chromosome 12 at 108,681,524 bp
  • A to G, chromosome 13 at 21,715,807 bp
  • T to C, chromosome 14 at 75,848,099 bp
  • CAGCTGGAGGAGC to CAGC, chromosome 15 at 78,436,913 bp
  • T to C, chromosome 15 at 78,967,986 bp
  • AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG to AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG, chromosome 16 at 91,660,334 bp
  • T to A, chromosome 17 at 27,708,639 bp
  • G to A, chromosome 17 at 28,550,728 bp
  • T to A, chromosome 17 at 35,101,311 bp
  • T to A, chromosome 17 at 65,833,098 bp
  • A to G, chromosome 19 at 6,106,244 bp
  • T to C, chromosome 19 at 24,900,230 bp
  • T to A, chromosome 19 at 56,848,702 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7972 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
046015-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.