Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7977Btlr/Mmmh
Stock Number:
046020-MU
Citation ID:
RRID:MMRRC_046020-MU
Other Names:
R7977 (G1)
Major Collection:

Strain Information

Hps5
Name: HPS5, biogenesis of lysosomal organelles complex 2 subunit 2
Synonyms: ru-2, ruby eye 2, ru2, Hermansky-Pudlak syndrome 5
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 246694
Homologene: 35333
Epha2
Name: Eph receptor A2
Synonyms: Sek-2, Eck, Sek2, Myk2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13836
HGNC: HGNC:3386
Homologene: 20929
Ank2
Name: ankyrin 2, brain
Synonyms: ankyrin B, Ank-2, Ankyrin-2, Ankyrin-B, Gm4392
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 109676
HGNC: HGNC:493
Adgre1
Name: adhesion G protein-coupled receptor E1
Synonyms: F4/80, DD7A5-7, TM7LN3, EGF-TM7, Ly71, Emr1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 13733
VEGA: 17
HGNC: HGNC:3336
Homologene: 1493
Hsp90ab1
Name: heat shock protein 90 alpha (cytosolic), class B member 1
Synonyms: Hsp84, Hsp90, Hsp84-1, C81438, Hspcb
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 15516
Homologene: 74306
Triobp
Name: TRIO and F-actin binding protein
Synonyms: Mus EST 478828, Tara, EST478828
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 110253
Homologene: 5104
Brd7
Name: bromodomain containing 7
Synonyms: bromodomain protein 75 kDa, BP75, CELTIX1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 26992
Homologene: 8085
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 172,505,253 bp
  • A to G, chromosome 2 at 25,084,766 bp
  • G to T, chromosome 2 at 32,574,305 bp
  • A to G, chromosome 2 at 70,330,933 bp
  • A to G, chromosome 2 at 76,891,561 bp
  • A to G, chromosome 3 at 36,644,169 bp
  • T to C, chromosome 3 at 126,945,707 bp
  • G to T, chromosome 4 at 125,066,939 bp
  • C to A, chromosome 4 at 141,308,480 bp
  • A to C, chromosome 5 at 41,795,070 bp
  • T to A, chromosome 5 at 76,543,585 bp
  • C to T, chromosome 5 at 109,340,149 bp
  • A to G, chromosome 5 at 123,147,680 bp
  • G to A, chromosome 5 at 124,719,986 bp
  • G to A, chromosome 5 at 135,375,680 bp
  • G to T, chromosome 5 at 139,392,685 bp
  • A to G, chromosome 5 at 144,175,141 bp
  • T to G, chromosome 6 at 24,763,866 bp
  • A to T, chromosome 6 at 58,008,279 bp
  • A to T, chromosome 7 at 3,841,697 bp
  • A to C, chromosome 7 at 22,583,387 bp
  • A to C, chromosome 7 at 46,769,051 bp
  • T to C, chromosome 7 at 89,876,111 bp
  • A to G, chromosome 7 at 127,328,298 bp
  • CGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGA to CGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGA, chromosome 8 at 66,860,494 bp
  • T to A, chromosome 8 at 78,697,214 bp
  • T to C, chromosome 8 at 88,334,141 bp
  • T to C, chromosome 8 at 106,259,894 bp
  • T to C, chromosome 9 at 19,920,314 bp
  • C to A, chromosome 9 at 22,073,484 bp
  • T to A, chromosome 9 at 41,977,561 bp
  • C to T, chromosome 10 at 79,793,705 bp
  • T to C, chromosome 10 at 129,625,969 bp
  • TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC to TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC, chromosome 11 at 100,189,077 bp
  • A to G, chromosome 12 at 83,775,382 bp
  • A to T, chromosome 13 at 22,395,855 bp
  • A to G, chromosome 14 at 21,669,863 bp
  • A to G, chromosome 14 at 62,951,931 bp
  • T to A, chromosome 15 at 5,100,525 bp
  • T to A, chromosome 15 at 6,467,462 bp
  • T to A, chromosome 15 at 79,001,544 bp
  • G to A, chromosome 15 at 81,851,480 bp
  • A to G, chromosome 15 at 86,032,993 bp
  • T to A, chromosome 15 at 99,328,098 bp
  • A to G, chromosome 16 at 4,037,970 bp
  • C to A, chromosome 16 at 33,720,730 bp
  • T to C, chromosome 17 at 20,846,897 bp
  • A to G, chromosome 17 at 30,744,524 bp
  • T to C, chromosome 17 at 34,710,220 bp
  • A to C, chromosome 17 at 45,571,606 bp
  • T to A, chromosome 17 at 57,447,987 bp
  • A to G, chromosome 18 at 65,698,391 bp
  • G to T, chromosome 18 at 68,235,669 bp
  • T to C, chromosome 19 at 55,277,973 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7977 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
046020-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.