Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR7985Btlr/Mmmh
Stock Number:
046026-MU
Citation ID:
RRID:MMRRC_046026-MU
Other Names:
R7985 (G1)
Major Collection:

Strain Information

Lamb1
Name: laminin B1
Synonyms: Lamb-1, C81607, C80098, D130003D08Rik, Lamb1-1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 16777
HGNC: HGNC:6486
Homologene: 1722
Calca
Name: calcitonin/calcitonin-related polypeptide, alpha
Synonyms: Cgrp, CA, alpha CGRP, Ctn, Ct, Calc, CT
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12310
HGNC: HGNC:1437
Homologene: 88337
Psenen
Name: presenilin enhancer gamma secretase subunit
Synonyms: 1700023M09Rik, Pen2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 66340
Homologene: 11952
Bahcc1
Name: BAH domain and coiled-coil containing 1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268515
Homologene: 129585
Dlg1
Name: discs large MAGUK scaffold protein 1
Synonyms: B130052P05Rik, SAP97, Dlgh1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 13383
HGNC: HGNC:2900
Homologene: 20869
Dock1
Name: dedicator of cytokinesis 1
Synonyms: D630004B07Rik, 9130006G06Rik, Dock180, b2b3190Clo
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 330662
HGNC: HGNC:2987
Homologene: 55575
Cuedc1
Name: CUE domain containing 1
Synonyms: C330016O16Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 103841
Homologene: 9933
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 53,518,727 bp
  • T to C, chromosome 1 at 93,576,524 bp
  • A to G, chromosome 1 at 140,108,826 bp
  • G to A, chromosome 1 at 155,312,895 bp
  • G to A, chromosome 1 at 173,760,206 bp
  • A to G, chromosome 1 at 184,732,026 bp
  • A to G, chromosome 2 at 26,919,276 bp
  • C to A, chromosome 2 at 68,664,349 bp
  • A to T, chromosome 2 at 91,646,431 bp
  • A to G, chromosome 2 at 125,301,878 bp
  • A to T, chromosome 2 at 127,745,909 bp
  • AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG to AGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGAGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAAGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCAAAAGGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGGGGCCAGAG, chromosome 2 at 180,595,057 bp
  • A to T, chromosome 3 at 72,936,961 bp
  • G to A, chromosome 4 at 11,367,153 bp
  • T to C, chromosome 4 at 41,630,055 bp
  • A to T, chromosome 4 at 140,932,092 bp
  • T to C, chromosome 5 at 76,658,050 bp
  • T to A, chromosome 5 at 87,092,124 bp
  • A to G, chromosome 5 at 142,127,847 bp
  • T to C, chromosome 6 at 8,573,186 bp
  • C to T, chromosome 6 at 83,480,932 bp
  • A to T, chromosome 6 at 122,850,005 bp
  • A to T, chromosome 7 at 3,841,697 bp
  • T to C, chromosome 7 at 30,562,078 bp
  • A to G, chromosome 7 at 56,165,244 bp
  • A to G, chromosome 7 at 114,635,178 bp
  • G to T, chromosome 7 at 134,746,954 bp
  • T to A, chromosome 7 at 140,296,893 bp
  • A to G, chromosome 8 at 4,203,536 bp
  • A to G, chromosome 8 at 70,720,527 bp
  • A to G, chromosome 8 at 85,725,568 bp
  • T to A, chromosome 9 at 38,523,943 bp
  • T to A, chromosome 9 at 64,177,930 bp
  • A to C, chromosome 9 at 119,170,638 bp
  • A to G, chromosome 10 at 26,078,783 bp
  • G to T, chromosome 10 at 123,016,308 bp
  • A to G, chromosome 11 at 58,732,706 bp
  • G to T, chromosome 11 at 66,375,164 bp
  • A to T, chromosome 11 at 88,182,516 bp
  • G to A, chromosome 11 at 98,702,447 bp
  • A to G, chromosome 11 at 120,272,891 bp
  • A to T, chromosome 11 at 120,642,920 bp
  • T to G, chromosome 12 at 28,553,972 bp
  • T to A, chromosome 12 at 31,300,215 bp
  • G to A, chromosome 12 at 81,314,993 bp
  • A to T, chromosome 12 at 112,778,963 bp
  • T to A, chromosome 13 at 64,176,046 bp
  • C to T, chromosome 13 at 105,119,974 bp
  • T to C, chromosome 14 at 20,728,410 bp
  • A to T, chromosome 14 at 50,891,505 bp
  • A to G, chromosome 14 at 55,496,952 bp
  • T to C, chromosome 15 at 76,361,487 bp
  • T to A, chromosome 15 at 101,016,962 bp
  • T to G, chromosome 16 at 31,788,105 bp
  • T to C, chromosome 16 at 85,798,114 bp
  • T to A, chromosome 17 at 34,717,010 bp
  • T to G, chromosome 17 at 36,167,553 bp
  • C to T, chromosome 17 at 55,953,997 bp
  • A to G, chromosome 17 at 65,984,196 bp
  • T to A, chromosome 19 at 39,113,986 bp
  • T to C, chromosome Y at 2,116,263 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R7985 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
046026-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.