Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8000Btlr/Mmmh
Stock Number:
046040-MU
Citation ID:
RRID:MMRRC_046040-MU
Other Names:
R8000 (G1)
Major Collection:

Strain Information

Pald1
Name: phosphatase domain containing, paladin 1
Synonyms: paladin, X99384
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 27355
VEGA: 10
Homologene: 8453
Kcna6
Name: potassium voltage-gated channel, shaker-related, subfamily, member 6
Synonyms: Kv1.6, MK1.6
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16494
HGNC: HGNC:6225
Homologene: 1684
Arhgef10
Name: Rho guanine nucleotide exchange factor 10
Synonyms: 6430549H08Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234094
Homologene: 22827
Slk
Name: STE20-like kinase
Synonyms: 9A2, mSLK, Etk4, SLK, Stk2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20874
Homologene: 22515
Xpo4
Name: exportin 4
Synonyms: B430309A01Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 57258
Homologene: 10733
Mier1
Name: MEIR1 treanscription regulator
Synonyms: 5830411K19Rik, 4933425I22Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 71148
Homologene: 136176
Actn1
Name: actinin, alpha 1
Synonyms: 3110023F10Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 109711
VEGA: 12
HGNC: HGNC:163
Homologene: 55553
Dock4
Name: dedicator of cytokinesis 4
Synonyms: EST N28122, 6330411N01Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238130
VEGA: 12
Homologene: 56680
Lars2
Name: leucyl-tRNA synthetase, mitochondrial
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 102436
VEGA: 9
Homologene: 6526
Rgp1
Name: RAB6A GEF compex partner 1
Synonyms: 1110029E03Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242406
Homologene: 8863
Son
Name: Son DNA binding protein
Synonyms: 2900011L12Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 20658
Homologene: 10551
Acaca
Name: acetyl-Coenzyme A carboxylase alpha
Synonyms: acetyl-CoA carboxylase, Acc1, LOC327983, Acac, A530025K05Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 107476
HGNC: HGNC:84
Homologene: 31015
Rnaseh2a
Name: ribonuclease H2, large subunit
Synonyms: 2400006P09Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 69724
Homologene: 4664
Rpl7
Name: ribosomal protein L7
Synonyms: Rpl7a, Surf-3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19989
Homologene: 87772
Stk38
Name: serine/threonine kinase 38
Synonyms: 5830476G13Rik, 9530097A09Rik, Ndr1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 106504
Homologene: 56033
Col4a4
Name: collagen, type IV, alpha 4
Synonyms: [a]4(IV), E130010M05Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12829
HGNC: HGNC:2206
Homologene: 20071
Ptprd
Name: protein tyrosine phosphatase receptor type D
Synonyms: 3000002J10Rik, B230219D21Rik, 1110002J03Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 19266
HGNC: HGNC:9668
Muc4
Name: mucin 4
Synonyms: 4933405I11Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 140474
HGNC: HGNC:7514
Homologene: 124469
Tecta
Name: tectorin alpha
Synonyms: [a]-tectorin, Tctna
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 21683
Homologene: 3955
Fras1
Name: Fraser extracellular matrix complex subunit 1
Synonyms: bl, E130113P14Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231470
Homologene: 23516
Fads2b
Name: fatty acid desaturase 2B
Synonyms: 4833423E24Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228151
Homologene: 105643
Mmp1a
Name: matrix metallopeptidase 1a (interstitial collagenase)
Synonyms: Mcol-A
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 83995
VEGA: 9
HGNC: HGNC:7155
Homologene: 20544
Vmn1r228
Name: vomeronasal 1 receptor 228
Synonyms: V1re3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 171226
Homologene: 74320
Samd9l
Name: sterile alpha motif domain containing 9-like
Synonyms: ESTM25
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 209086
HGNC: HGNC:1349
Homologene: 7707
Nell2
Name: NEL-like 2
Synonyms: mel91, A330108N19Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 54003
VEGA: 15
HGNC: HGNC:7751
Homologene: 4488
Akt3
Name: thymoma viral proto-oncogene 3
Synonyms: PKB gamma, D930002M15Rik, Nmf350
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 23797
HGNC: HGNC:393
Homologene: 55904
Mertk
Name: MER proto-oncogene tyrosine kinase
Synonyms: Tyro 12, Nyk, Eyk, Mer, nmf12
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17289
HGNC: HGNC:7027
Homologene: 4626
Dmwd
Name: dystrophia myotonica-containing WD repeat motif
Synonyms: 59, DMR-N9, Dm9
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13401
HGNC: HGNC:2936
Homologene: 22559
Kyat1
Name: kynurenine aminotransferase 1
Synonyms: cytoplasmic (glutamine transaminase K, kyneurenine aminotransferase), 2010009K05Rik, KATI, Kat1, Ccbl1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 70266
HGNC: HGNC:1564
Homologene: 37872
Fap
Name: fibroblast activation protein
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14089
HGNC: HGNC:3590
Homologene: 48282
Or10h1
Name: olfactory receptor family 10 subfamily H member 1
Synonyms: GA_x6K02T2KN0P-2543-1596, MOR267-10, Olfr239
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 100038860
Homologene: 110515
Zfp503
Name: zinc finger protein 503
Synonyms: B830002A16Rik, Nolz-1, Nolz1, ZNF503, Zpo2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 218820
Homologene: 41888
Aadacl2
Name: arylacetamide deacetylase like 2
Synonyms: EG639634
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 639634
Homologene: 28634
Fbh1
Name: F-box DNA helicase 1
Synonyms: Fbx18, Fbxo18
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 50755
Homologene: 9272
Pex13
Name: peroxisomal biogenesis factor 13
Synonyms: 2610008O20Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 72129
HGNC: HGNC:8855
Homologene: 1967
Slc7a10
Name: solute carrier family 7 (cationic amino acid transporter, y+ system), member 10
Synonyms: Asc-1, D7Bwg0847e
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 53896
Homologene: 56767
Or4d10c
Name: olfactory receptor family 4 subfamily D member 10C
Synonyms: GA_x6K02T2RE5P-2447610-2446675, MOR239-1, Olfr1426
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258805
Homologene: 128079
Celf4
Name: CUGBP, Elav-like family member 4
Synonyms: BRUNOL-4, Brul4, C130060B05Rik, A230070D14Rik, Brunol4
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 108013
VEGA: 18
Homologene: 23202
Or12j2
Name: olfactory receptor family 12 subfamily J member 2
Synonyms: GA_x6K02T2PBJ9-42486061-42486978, MOR251-5, Olfr527
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 257939
Homologene: 73958
Gabra4
Name: gamma-aminobutyric acid type A receptor subunit alpha 4
Synonyms: Gabra-4
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14397
HGNC: HGNC:4078
Homologene: 631
Slc35f3
Name: solute carrier family 35, member F3
Synonyms: B230375D17Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 210027
Homologene: 62481
Frey1
Name: Frey regulator of sperm-oocyte fusion 1
Synonyms: 1700029I15Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 75641
Homologene: 18833
Prxl2a
Name: peroxiredoxin like 2A
Synonyms: 5730469M10Rik, Adrx, Adiporedoxin, Fam213a
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 70564
Homologene: 12356
Igkv9-124
Name: immunoglobulin kappa chain variable 9-124
Synonyms: Gm4966
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243431
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 16,102,725 bp
  • G to A, chromosome 1 at 82,541,297 bp
  • A to T, chromosome 1 at 177,050,197 bp
  • A to T, chromosome 2 at 11,767,289 bp
  • A to C, chromosome 2 at 30,192,053 bp
  • G to T, chromosome 2 at 52,288,844 bp
  • A to G, chromosome 2 at 62,502,798 bp
  • A to G, chromosome 2 at 85,518,726 bp
  • A to G, chromosome 2 at 92,385,527 bp
  • A to G, chromosome 2 at 128,771,498 bp
  • A to G, chromosome 3 at 60,017,375 bp
  • T to A, chromosome 4 at 43,581,664 bp
  • A to C, chromosome 4 at 76,066,242 bp
  • A to T, chromosome 4 at 103,131,043 bp
  • A to G, chromosome 5 at 71,623,961 bp
  • A to G, chromosome 5 at 96,762,677 bp
  • A to T, chromosome 6 at 3,373,034 bp
  • T to A, chromosome 6 at 67,942,152 bp
  • C to A, chromosome 6 at 126,738,985 bp
  • C to T, chromosome 7 at 19,080,735 bp
  • A to G, chromosome 7 at 35,200,440 bp
  • T to A, chromosome 7 at 140,336,342 bp
  • T to G, chromosome 8 at 14,930,054 bp
  • G to A, chromosome 8 at 84,966,049 bp
  • A to G, chromosome 8 at 126,321,073 bp
  • C to A, chromosome 9 at 7,476,214 bp
  • A to T, chromosome 9 at 42,367,184 bp
  • G to A, chromosome 9 at 123,436,244 bp
  • T to C, chromosome 10 at 61,347,439 bp
  • A to C, chromosome 11 at 23,655,915 bp
  • A to G, chromosome 11 at 84,392,231 bp
  • T to A, chromosome 12 at 40,833,119 bp
  • A to G, chromosome 12 at 80,199,008 bp
  • T to C, chromosome 14 at 21,986,159 bp
  • A to C, chromosome 14 at 40,994,526 bp
  • T to C, chromosome 14 at 57,589,946 bp
  • T to A, chromosome 15 at 95,435,274 bp
  • C to G, chromosome 16 at 32,753,930 bp
  • AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG to AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG, chromosome 16 at 91,660,334 bp
  • A to T, chromosome 17 at 20,776,965 bp
  • A to T, chromosome 17 at 28,992,448 bp
  • G to C, chromosome 17 at 33,199,347 bp
  • T to C, chromosome 18 at 25,504,517 bp
  • T to C, chromosome 19 at 12,087,994 bp
  • G to T, chromosome 19 at 47,608,905 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8000 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
046040-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.