Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8000Btlr/Mmmh
Stock Number:
046040-MU
Citation ID:
RRID:MMRRC_046040-MU
Other Names:
R8000 (G1)
Major Collection:

Strain Information

Pald1
Name: phosphatase domain containing, paladin 1
Synonyms: paladin, X99384
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 27355
VEGA: 10
Homologene: 8453
Kcna6
Name: potassium voltage-gated channel, shaker-related, subfamily, member 6
Synonyms: Kv1.6, MK1.6
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16494
HGNC: HGNC:6225
Homologene: 1684
Arhgef10
Name: Rho guanine nucleotide exchange factor 10
Synonyms: 6430549H08Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234094
Homologene: 22827
Slk
Name: STE20-like kinase
Synonyms: 9A2, mSLK, Etk4, SLK, Stk2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20874
Homologene: 22515
Xpo4
Name: exportin 4
Synonyms: B430309A01Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 57258
Homologene: 10733
Mier1
Name: MEIR1 treanscription regulator
Synonyms: 5830411K19Rik, 4933425I22Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 71148
Homologene: 136176
Actn1
Name: actinin, alpha 1
Synonyms: 3110023F10Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 109711
VEGA: 12
HGNC: HGNC:163
Homologene: 55553
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 16,102,725 bp
  • G to A, chromosome 1 at 82,541,297 bp
  • A to T, chromosome 1 at 177,050,197 bp
  • A to T, chromosome 2 at 11,767,289 bp
  • A to C, chromosome 2 at 30,192,053 bp
  • G to T, chromosome 2 at 52,288,844 bp
  • A to G, chromosome 2 at 62,502,798 bp
  • A to G, chromosome 2 at 85,518,726 bp
  • A to G, chromosome 2 at 92,385,527 bp
  • A to G, chromosome 2 at 128,771,498 bp
  • A to G, chromosome 3 at 60,017,375 bp
  • T to A, chromosome 4 at 43,581,664 bp
  • A to C, chromosome 4 at 76,066,242 bp
  • A to T, chromosome 4 at 103,131,043 bp
  • A to G, chromosome 5 at 71,623,961 bp
  • A to G, chromosome 5 at 96,762,677 bp
  • A to T, chromosome 6 at 3,373,034 bp
  • T to A, chromosome 6 at 67,942,152 bp
  • C to A, chromosome 6 at 126,738,985 bp
  • C to T, chromosome 7 at 19,080,735 bp
  • A to G, chromosome 7 at 35,200,440 bp
  • T to A, chromosome 7 at 140,336,342 bp
  • T to G, chromosome 8 at 14,930,054 bp
  • G to A, chromosome 8 at 84,966,049 bp
  • A to G, chromosome 8 at 126,321,073 bp
  • C to A, chromosome 9 at 7,476,214 bp
  • A to T, chromosome 9 at 42,367,184 bp
  • G to A, chromosome 9 at 123,436,244 bp
  • T to C, chromosome 10 at 61,347,439 bp
  • A to C, chromosome 11 at 23,655,915 bp
  • A to G, chromosome 11 at 84,392,231 bp
  • T to A, chromosome 12 at 40,833,119 bp
  • A to G, chromosome 12 at 80,199,008 bp
  • T to C, chromosome 14 at 21,986,159 bp
  • A to C, chromosome 14 at 40,994,526 bp
  • T to C, chromosome 14 at 57,589,946 bp
  • T to A, chromosome 15 at 95,435,274 bp
  • C to G, chromosome 16 at 32,753,930 bp
  • AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG to AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG, chromosome 16 at 91,660,334 bp
  • A to T, chromosome 17 at 20,776,965 bp
  • A to T, chromosome 17 at 28,992,448 bp
  • G to C, chromosome 17 at 33,199,347 bp
  • T to C, chromosome 18 at 25,504,517 bp
  • T to C, chromosome 19 at 12,087,994 bp
  • G to T, chromosome 19 at 47,608,905 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8000 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.

Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain's tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
046040-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.