Strain Name:
Stock Number:
Citation ID:
Major Collection:

Gene Information

Name: integrator complex subunit 7; endonuclease-mediated mutation 1, Jackson
Type: Allele
Species: Mus musculus (mouse)
Alteration at locus: CRISPR
Name: integrator complex subunit 7
Synonyms: 5930412E23Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: CRISPR
NCBI: 77065
Homologene: 9136
Genetic Alterations
intragenic deletion
Genotype Determination
Phenotyping data may be available at
Strain Development
This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 4 guide sequences CAAATACTAACTTATACAGG, TTAAATCTCATATTAAAGTA, TGTCAAATACTAACTTATAC and ATTGTAGGCTTTCTTACAGA, which resulted in a 515 bp deletion beginning at Chromosome 1 position 191,582,302 bp and ending after 191,582,816 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000286639 (exon 2) and 385 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 31 and early truncation 11 amino acids later.
Suggested Control Mice
C57BL/6NJ or wild-type from colony
Stephen Murray, Ph.D., The Jackson Laboratory.

Colony and Husbandry Information

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email .
Coat Color
Overall Breeding Performance
Viability and Fertility: Female Male Comments
Homozygotes are viable: Undetermined Undetermined Undetermined
Homozygotes are fertile: Undetermined Undetermined Undetermined
Heterozygotes are fertile: Undetermined Undetermined Undetermined
Age Reproductive Decline: Undetermined Undetermined
Average litter size
Average Pups Weaned

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
046060-JAX-SPERM Cryo-preserved spermatozoa $437.00 / $437.00
Non-Profit / For-Profit
Aliquot Approximate quantity3
046060-JAX-RESUS Litter recovered from cryo-archive $2,022.00 / $2,022.00
Non-Profit / For-Profit
Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.