Strain Name:
B6J;B6N(Cg)-Cdkl5tm1.1Arikk/Mmucd
Stock Number:
050620-UCD
Citation ID:
RRID:MMRRC_050620-UCD
Other Names:
CDKL5 Floxed

Gene Information

Cdkl5tm1.1Arikk
Name: cyclin-dependent kinase-like 5; targeted mutation 1, Jyothi Arikkath
Type: Allele
Species: Mus musculus (mouse)
Chromosome: X
Cdkl5
Name: cyclin-dependent kinase-like 5
Synonyms: Stk9
Type: Gene
Species: Mus musculus (mouse)
Chromosome: X
NCBI: 382253
Homologene: 55719
Genetic Alterations
Cdkl5 exon 3 floxed.
ES Cell Line
C2 derived from C57BL/6NTac
Phenotype
Wild-type
Strain Development
The mouse CDKL5 gene consists of 22 exons of which the fourth exon was targeted for creating a conditional knockout allele. The targeting construct was commercially synthesized that contained left and right homology arms of 7.3 and 6 kilobases respectively along with the upstream LoxP site in intron 3 and a Frt-Neo-Frt-LoxP cassette in intron 4. If a truncated protein is expressed from the upstream exons, it will produce only about 33 amino acid polypeptides, along with another 29 amino acids originating from frameshifted reading of exon 6. Upon Cre-mediated deletion of exon 4, the transcript will undergo nonsense-mediated decay due to a frameshift in the protein coding sequence of the downstream exons. The targeting construct was linearized and electroporated into C57BL6/N-derived ES cells (PMID:20582321); the positive clones were screened by long-range PCRs and confirmed by Southern blotting. The ES cell clones were injected into B6(Cg)-Tyrc-2J/J (JAX Strain #000058) strain-derived blastocysts, to generate chimeras, at the mouse genome engineering core facility, UNMC, which were mated to B6(Cg)-Tyrc-2J/J. The strain was FLP'ed with C57BL/6-Tg(CAG-Flpo)1Afst/Mmucd mice (MMRRC:32247) that were backcrossed to B6(Cg)-Tyrc-2J/J at U of Michigan. A genotyping PCR assay was developed for detecting the conditional knockout allele. The primer pairs were CDKL5 Flox F TGCTCTTGGAGTATGTTGATTGAC and CDKL5 Flox R ACTTGGAATCATAATACTGTATACCTTG. The expected amplicons sizes are 204 and 267 bp, for wild-type and conditional KO alleles, respectively.
Suggested Control Mice
Wild-type, or cre only, or floxed only
Donor
Jyothi Arikkath, Ph.D., University of Nebraska Medical Center.
Primary Reference

Schroeder E, Yuan L, Seong E, Ligon C, DeKorver N, Gurumurthy CB, Arikkath J. Neuron-Type Specific Loss of CDKL5 Leads to Alterations in mTOR Signaling and Synaptic Markers. Mol Neurobiol. 2018 Oct 4. doi: 10.1007/s12035-018-1346-8. [Epub ahead of print] (Medline PMID: 30288694)

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@ucdavis.edu .
Coat Color
Black
Eye
Black
MMRRC Breeding System
Random intra-strain mating
Generation
N2+ (C57BL/6J), F2+
Overall Breeding Performance
Good
NOTE: "Hemizygote" as used here refers to males carrying a mutation on the X Chromosome or mice of either sex carrying an inserted transgene with no homologous allele on the other chromosome.
Viability and Fertility: Female Male Comments
Homozygotes are viable: Yes Yes
Homozygotes are fertile: Yes Yes
Hetero/Hemizygotes are fertile: Yes Yes
Age Reproductive Decline: Undetermined Undetermined
Bred to Homozygosity
Yes
Average litter size
7-9
Recommended wean age
4 Weeks
Average Pups Weaned
5-9

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@ucdavis.edu for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $) Units Notes
050620-UCD-EMBRYO Cryo-preserved embryos $1,038.00 / Non-Profit Aliquot Approximate quantity2 : 20-40 embryos / aliquot
050620-UCD-SPERM Cryo-preserved spermatozoa $546.25 / Non-Profit Aliquot Approximate quantity3
050620-UCD-RESUS Litter recovered from cryo-archive $3,033.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.