Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-Zfp30em1Snpk/Mmnc
Stock Number:
050629-UNC
Citation ID:
RRID:MMRRC_050629-UNC
Other Names:
Zfp30 Knockout

Strain Information

Zfp30em1Snpk
Name: zinc finger protein 30; endonuclease-mediated mutation 1, Samir Kelada
Type: Allele
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: CRISPR
Zfp30
Name: zinc finger protein 30
Synonyms: Zfp-30, 2610306P15Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22693
Homologene: 84799
Genetic Alterations
Zfp30 knockout via CRISPR/Cas9 targeting the 5' end of exon 5. Additional details is found in the Development section
Genotype Determination
  • Genotyping Protocol(s)
  • Center protocol and contact for technical support will be shipped with mice.
  • Phenotype
    The mouse is normal with respect to most phenotypes examined, but blood glucose is significantly lower.
    Strain GQC Summary
    Coisogenic strain carrying the em1Snpk allele of the Zfp30 gene on C57BL/6J background. C57BL/6J was detected with diagnostic alleles. The genome of this strain is fully replicable. This GQC report is based on the MiniMUGA G3 2024 pipeline using 2 samples genotyped in 2021.
    MMRRC Strain GQC Report
    Suggested Control Mice
    Littermates of all relevant genotypes.
    • Immunology and Inflammation
    • Metabolism
    Submitter
    Samir Kelada, Ph.D., University of North Carolina.
    Strain Development
    A CRISPR/Cas9 guide RNA was designed to target the mouse Zfp30 gene near the 5’ end of exon 5. The guide RNA was produced by T7 in vitro transcription and validated in vitro by incubating guide RNA, Cas9 enzyme and plasmid harboring the guide RNA target site, followed by gel electrophoresis to determine the extent of in vitro cleavage activity. The 20-bp guide RNA protospacer sequence was 5’-GAATCCAGATACAGCAGTAA-3’.

    Donor oligonucleotide Z30-H1-T (5’-GTTTTTCTTCTTTTTGCTTTCAGATCTGGAATCCAGATACAGCTGATAGGATCCTAGACCGGTAACGGGTTACTTCCAGAAAAGAATACTTACGAAATTAATCTATCT-3’) was used for homologous recombination to insert stop codons and a BamHI restriction site at the target site.

    Embryo Microinjection: C57BL/6J females were superovulated by injection with pregnant mare’s serum gonadotropin (PMSG) and human chorionic gonadotropin (HCG) and then mated with C57BL/6J stud males for zygote production. One-cell embryos were collected from the ampulla oviducts the morning after mating and microinjected with either “low” or “high” mix, containing, respectively, 20 ng/ul or 100 ng/ul in vitro transcribed Cas9 mRNA, 20 ng/ml or 50 ng/ml Zfp30 guide RNA, and 100 ng/ml Z30-H1-T donor oligonucleotide. The microinjected embryos were then implanted into pseudopregnant recipients.

    Founder Genotyping: 14 live pups born from microinjected embryos were screened by PCR amplification of the Zfp30 target site followed by digestion of the PCR product with BamHI restriction enzyme. The BamHI restriction site was detected in 9/14 animals. Two founders with apparent biallelic insertion of the BamHI restriction site were mated to C57BL/6J animals for germline transmission of the targeted allele. A single founder line was subsequently backcrossed to C57BL/6J two times to remove any off-target mutations.

    Off-target Analysis: The founder animals harboring Zfp30 mutations were screened for mutations at 10 potential off-target sites predicted by the website crispr.mit.edu. Each potential off-target site was PCR-amplified and products were analyzed by the T7endo1 assay. Founders chosen for line establishment were further analyzed by Sanger sequencing of PCR products for all 10 off-target sites. Both founders chosen for breeding had indel mutations at site OT2. Hence, these mice were backcrossed to C57BL/6J mice two times and offspring were selected for by genotyping (by sequencing).

    Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain's tissue samples taken when archived by or ordered from the assigned MMRRC Center.

    Colony and Husbandry Information

    Colony Surveillance Program and Current Health Reports

    Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc_health@med.unc.edu.
    Coat Color
    Black
    Eye
    Black
    MMRRC Breeding System
    Sib-mating
    Generation
    N3 (C57BL/6J)
    F10
    Overall Breeding Performance
    Good
    Viability and Fertility: Female Male Comments
    Homozygotes are viable: Yes Yes
    Homozygotes are fertile: Yes Yes
    Heterozygotes are fertile: N/A N/A
    Age Reproductive Decline: Undetermined Undetermined
    Bred to Homozygosity
    Yes
    Average litter size
    4-6
    Recommended wean age
    3 Weeks
    Average Pups Weaned
    4-6

    Order Information

    Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

    Cryopreserved material may be available upon request, please inquire to mmrrc@med.unc.edu for more information.

    Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

    The submitter or their institution limits the distribution to non-profit institutions only.

    Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

    Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
    MMRRC Item # Description Distribution Fee / Unit (US $)
    *Shipping & Handling not included*
    Units Notes
    050629-UNC-EMBRYO Cryo-preserved embryos $1,562.00 / Non-Profit Aliquot Approximate quantity2 : 20-40 embryos / aliquot
    050629-UNC-SPERM Cryo-preserved spermatozoa $520.00 / Non-Profit Aliquot Approximate quantity3
    050629-UNC-RESUS Litter recovered from cryo-archive $3,242.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.

    1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

    2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

    3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

    4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

    To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.