MMRRC:050703-UNC

CRISPR/Cas9 was used to delete a chromosomal region containing Cyp2b9, Cyp2b10, and Cyp2b13. The triple knockout does not contain any of these primarily hepatic Cyp2b members.

Cyp2b10 - cytochrome P450, family 2, subfamily b, polypeptide 10 (MGI:88598)
Cyp2b9 - cytochrome P450, family 2, subfamily b, polypeptide 9 (MGI:88600)
Cyp2b13 - cytochrome P450, family 2, subfamily b, polypeptide 13 (MGI:88599)

Genotype Determination

Genotyping Protocol(s)

Center protocol and contact for technical support will be shipped with mice.

Strain Description [Including phenotype, strain background, strain development and suggested control mice]

Phenotype

The Cyp2b members are crucial in the metabolism of several pharmaceuticals and toxicants. While the differential metabolism has not been investigated by the strain's donor, it is suspected that that several chemicals such as efavirenz and parathion are differentially metabolized. A "knockdown" mouse made earlier was more sensitive to parathion and zoxazolamine.

The mice are diet-induced obese. At the time of donation, the donor examined whether (and why) the animals are more susceptible to non-alcoholic fatty liver disease (NAFLD). Manuscript on diet-induced obesity was submitted to J Nutr Biochem.

MeSH Terms

Animals
Aryl Hydrocarbon Hydroxylases/genetics
Aryl Hydrocarbon Hydroxylases/metabolism
CRISPR-Cas Systems
Cytochrome P-450 Enzyme System/genetics
Cytochrome P-450 Enzyme System/metabolism
Cytochrome P450 Family 2/genetics

Cytochrome P450 Family 2/metabolism
Female
Gene Deletion
Gene Expression
Mice
Mice, Inbred C57BL
Mice, Knockout
Pharmacological and Toxicological Phenomena
Receptors, Cytoplasmic and Nuclear/genetics
Receptors, Cytoplasmic and Nuclear/metabolism
Steroid Hydroxylases/genetics
Steroid Hydroxylases/metabolism

Strain Development

Cyp2b9/10/13-null mice were produced using the CRISPR/Cas9 system. Cyp2b9, Cyp2b10, and Cyp2b13 are the three Cyp2b members primarily expressed in the liver and found in a tandem repeat.

Each of the three hepatic genes was targeted. Cas9 mRNA from Streptococcuspyogenes and a 20-nt guide sequence that was specific to the target site with an 83-nt scaffold sequence, which was common to all the sgRNAs was injected into the cytoplasm of the mouse blastocyst (C57BL/6).
The scaffold sequence was guuuuagagcuagaaauagcaaguuaaaauaaggcuaguccguuaucaacuugaaaaaguggcaccgagucggugcuuuuuuu.
The Cyp2b10 guide sequence was: uguggaggagcggauucagg(AGG).
The Cyp2b13 guide sequence was: (CCC)ugcaagagguuccccaagag.
The Cyp2b9 guide sequence was: acattgatacctaccttctg(AGG).
The protospacer adjacent motif (PAM) is shown in parentheses.
The incorporation efficiency at each site in vitro was Cyp2b10, 47.6%, Cyp2b13, 33.3%, and Cyp2b9, 33.3%.
The resultant injection of more than 100 embryos produced two mice with a 287-kB deletion lacking all three hepatic Cyp2b members found in a tandem repeat.
Corresponding WT controls (C57BL/6J) were obtained from The Jackson Laboratory (Bar Harbor, ME) and used to produce the Cyp2b9/10/13-null mice and to demonstrate germline transmission.
Mating of heterozygotes produced a small proportion of homozygotes null for Cyp2b9/10/13 as determined by genotyping (see protocol).

Suggested Control Mice

C57BL/6J or humanized CYP2B6 mice (another strain we developed from breeding with a collaborator's transgenic line.

MMRRC Genetic QC

MMRRC Genetic QC Summary

The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@med.unc.edu. Older strains may not have this information.

Research Applications

Metabolism
Obesity

Strain Origin

Donor

William Baldwin, Ph.D., Clemson University.

Primary Reference

Kumar R, Mota LC, Litoff EJ, Rooney JP, Boswell WT, Courter E, Henderson CM,Hernandez JP, Corton JC, Moore DD, Baldwin WS. Compensatory changes in CYPexpression in three different toxicology mouse models: CAR-null, Cyp3a-null, and Cyp2b9/10/13-null mice. PLoS One. 2017 Mar 28;12(3):e0174355. doi:10.1371/journal.pone.0174355. eCollection 2017. (Medline PMID: 28350814)

Colony and Husbandry Information Expand All

Health Status Report

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc_health@med.unc.edu.

Appearance

Coat Color

Black

Eye

Black

Breeding

MMRRC Breeding System

Random intra-strain mating

Generation

N3-4 (C57BL/6J)

Overall Breeding Performance

Good

Reproductive Statistics

Viability and Fertility:	Female	Male
Homozygotes are viable:	Yes	Yes
Homozygotes are fertile:	Yes	Yes
Heterozygotes are fertile:	Yes	Yes
Age Reproductive Decline:	8 to 12 months	Greater than 12 months

Bred to Homozygosity

Yes

Average litter size

4-6

Recommended wean age

3 Weeks

Average Pups Weaned

4-6

Order Request Information Expand All

Availability Level

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@med.unc.edu for more information.

Conditions of Distribution [Including applicable technology transfer agreements]

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Fees

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)

MMRRC Item #	Description	Distribution Fee / Unit (US $) Shipping & Handling not included	Units	Notes
050703-UNC-EMBRYO	Cryo-preserved embryos	$1,404.00 / $2,331.00 Non-Profit / For-Profit	Aliquot	Approximate quantity² : 20-40 embryos / aliquot
050703-UNC-SPERM	Cryo-preserved spermatozoa	$564.00 / $937.00 Non-Profit / For-Profit	Aliquot	Approximate quantity³
050703-UNC-RESUS	Litter recovered from cryo-archive	$2,914.00 / $4,837.00 Non-Profit / For-Profit	Litter	Recovered litter⁴; additional fees for any special requests.

¹ The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

² An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

³ An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

⁴ The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.

Strain Detail Sheet

Strain Information Expand All

Colony and Husbandry Information Expand All

Order Request Information Expand All