Loading Mouse GIF
Loading...

Strain Name:
B6.129X1-Pkd2l1tm1Jzh/Mmnc
Stock Number:
050751-UNC
Citation ID:
RRID:MMRRC_050751-UNC
Other Names:
PKDL/PKD2L1

Strain Information

Pkd2l1tm1Jzh
Name: polycystic kidney disease 2-like 1; targeted mutation 1, Jing Zhou
Synonyms: Pkdl-
Type: Allele
Species: Mus musculus (mouse)
Chromosome: 19
Alteration at locus: Knockout
Pkd2l1
Name: polycystic kidney disease 2-like 1
Synonyms: polycystin-L, Pkdl, PCL, TRPP3, PKD2L
Type: Gene
Species: Mouse
Chromosome: 19
Alteration at locus: Knockout
NCBI: 329064
HGNC: HGNC:9011
Homologene: 22946
Genetic Alterations
Exons 3 and 4 were replaced with a neomycin selection cassette.
Genotype Determination
  • Genotyping Protocol(s)
  • Center protocol and contact for technical support will be shipped with mice.
  • ES Cell Line
    REK3
    Phenotype
    Disruption of polycystin-L causes hippocampal and thalamocortical hyperexcitability.
    MeSH Terms
    • Animals
    • Calcium Channels/deficiency
    • Calcium Channels/genetics
    • Cerebral Cortex/metabolism
    • Cerebral Cortex/pathology
    • Cilia/metabolism
    • Cilia/pathology
    • Cyclic AMP/metabolism
    • Cyclic AMP Response Element-Binding Protein/genetics
    • Cyclic AMP Response Element-Binding Protein/metabolism
    • Disease Models, Animal
    • Disease Susceptibility
    • Epilepsy/chemically induced
    • Epilepsy/genetics
    • Epilepsy/metabolism
    • Epilepsy/pathology
    • Excitatory Postsynaptic Potentials
    • Gene Deletion
    • Gene Expression Regulation, Developmental
    • Hippocampus/metabolism
    • Hippocampus/pathology
    • Humans
    • Ion Transport
    • Mice
    • Neurons/metabolism
    • Neurons/pathology
    • Pentylenetetrazole
    • Receptors, Adrenergic, beta-2/genetics
    • Receptors, Adrenergic, beta-2/metabolism
    • Receptors, Cell Surface/deficiency
    • Receptors, Cell Surface/genetics
    • Signal Transduction
    • Thalamus/metabolism
    • Thalamus/pathology
    Strain Development
    Degenerative PCR primer derived from a human PKDL or PKD2L1 cDNA sequence, and AP1, 5′CCATCCTAATACG ACTCACTATAGGGC3′ (Clontech, Palo Alto, CA, USA), was used to carry out rapid amplification of cDNA ends (RACE) on mouse brain marathon-ready™ cDNA. AdvanTaq™ DNA polymerase (Clontech) was used to perform touch-down PCR with cycling parameters as follows: initial denaturation at 94°C for 30 s; 5 cycles of 94°C for 10 s, 72°C for 4 min; 5 cycles of 94°C for 10 s, 70°C for 4 min; 25 cycles of 94°C for 5 s, 68°C for 4 min and final extension at 68°C for 7 min. PCR products were separated on a 1% agarose gel, and all resulting DNA fragments were excised and isolated. The products were purified and sequenced directly. For 5′ RACE amplification to obtain a full-length cDNA sequence, PCR was performed with the primer AP1 and mR902, 5′GTGGATTTCCAGGATTTCCTCCACCA3′. A second amplification was performed using the 2 μl of the diluted first PCR product (1:100) with the nested primers AP2, 5′ACTCACTATAGGGCTCGAGCGGC3′ (Clontech), and mR902. For 3′ RACE amplification, primers AP1 and mF903, 5′CACAAGCTACAGCGGGGGTGGCTACT3′ were used to perform the first PCR on the mouse brain cDNA. AP2 and mF902, 5′TACAGCGGGGGTGGCTACTACTTGGA3′, were used to perform nested PCR for 3′ RACE. 5′ and 3′ RACE products were cloned and both strands sequenced. The sequences were aligned to give an overall consensus sequence. A 10 kb NotI fragment was isolated from a mouse genomic library. The 7 kb NotI–NsiI fragment containing intron 2 of the Pkd2l1 gene was used to insert into a vector containing a neomycin-resistant gene with a PGK promoter, serving as a long arm of homologous recombination. A 0.9 kb short arm was created with the PCR method containing parts of intron 4 and exon 5, and inserted into the upstream of PGK–Neo cassette. Therefore, in this strategy, exons 3 and 4 were deleted. The Pkd2l1 targeting vector was linearized with NotI and used at a concentration of 22 mg/ml for electroporation. REK 3 embryonic stem cells were used at a concentration of 1.2 × 107 cells/ml. Colonies that survived 10 days in G418 (0.3 mg/ml; 66% active; GIBCO) were screened by PCR and Southern blot. Two recombinant cell lines were injected into C57BL/6 blastocysts to generate chimeric mice and contributed to the germ-line. Chimeras were bred to 129X1/SvJ.
    Suggested Control Mice
    C57BL/6
    MMRRC Genetic QC Summary
    The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@med.unc.edu. Older strains may not have this information.
    • Developmental Biology
    • Internal/Organ
    • Models for Human Disease
    • Neurobiology
    • Research Tools
    Donor
    Jing Zhou, M.D., Harvard Medical School - Brigham and Woman's Hospital.
    Primary Reference

    Yao G, Luo C, Harvey M, Wu M, Schreiber TH, Du Y, Basora N, Su X, Contreras D,Zhou J. Disruption of polycystin-L causes hippocampal and thalamocorticalhyperexcitability. Hum Mol Genet. 2016 Feb 1;25(3):448-58. doi:10.1093/hmg/ddv484. Epub 2015 Nov 26. (Medline PMID: 26612203)

    Colony and Husbandry Information

    Colony Surveillance Program and Current Health Reports

    Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc_health@med.unc.edu.
    Coat Color
    Black
    Eye
    Black
    MMRRC Breeding System
    Intra-strain mate
    Breeding Scheme(s)
    DI Backcrossed initially for ~10 generations, then did intra-strain mating to produce homozygous line
    Generation
    N10 (C57BL/6), F? ("many")
    Overall Breeding Performance
    Good
    Viability and Fertility: Female Male Comments
    Homozygotes are viable: Yes Yes
    Homozygotes are fertile: Yes Reduced
    Heterozygotes are fertile: Yes Yes
    Age Reproductive Decline: 8 to 12 months Greater than 12 months
    Average litter size
    7-9
    Recommended wean age
    3 Weeks
    Average Pups Weaned
    5-9

    Order Request Information

    Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

    Cryopreserved material may be available upon request, please inquire to mmrrc@med.unc.edu for more information.

    The donor or their institution limits the distribution to non-profit institutions only.

    Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

    Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

    Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
    MMRRC Item # Description Distribution Fee / Unit (US $)
    *Shipping & Handling not included*
    Units Notes
    050751-UNC-RESUS Litter recovered from cryo-archive $3,088.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
    Cryopreserved material may be available upon request, please inquire to mmrrc@med.unc.edu for more information.

    1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

    2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

    3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

    4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

    To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.