Strain Name:
FVB/NJ-Zfp423em2Haml/Mmucd
Stock Number:
051011-UCD
Citation ID:
RRID:MMRRC_051011-UCD
Other Names:
Zfp423-P913L

Strain Information

Zfp423em2Haml
Name: zinc finger protein 423; endonuclease-mediated mutation 2, Bruce Hamilton
Synonyms: Zfp423-P913L, Zfp423P913-FVB
Type: Allele
Species: Mus musculus (mouse)
Chromosome: 8
Alteration at locus: CRISPR
Zfp423
Name: zinc finger protein 423
Synonyms: Ebfaz, Roaz, Zfp104, ataxia1
Type: Gene
Species: Mouse
Chromosome: 8
Alteration at locus: CRISPR
NCBI: 94187
Homologene: 9010
Genetic Alterations
Reported patient variant P913L (PMID:22863007) engineered into mice. C-to-T transition in Zp423 on Chromosome 8, with two adjacent silent substitutions: TCACAACATCCGGCCCGGCGAGG to TCACAAtATCCGGCtgGGCGAGG. Predicted to replace proline with leucine at position 913 relative to human NP_055884.2, position 921 relative to mouse NP_201584.2 (NM_033327.2:c.2762C>T, predicting p.Pro921Leu).
Genotype Determination
Phenotype
Homo: Normal, in contrast to disease assertion for human equivalent in ClinVar.Het/Hemi: None noted.
MeSH Terms
  • Animals
  • Cilia/metabolism
  • DNA Damage
  • DNA-Binding Proteins/metabolism
  • Exome
  • Gene Knockdown Techniques
  • Genes, Recessive
  • Humans
  • Kidney Diseases, Cystic/genetics
  • MRE11 Homologue Protein
  • Mice
  • Microtubule Proteins/metabolism
  • Proteins
  • Signal Transduction
  • Zebrafish/embryology
  • Zebrafish/metabolism
Strain Development
Cas9 RNP and oligonucleotides injectied into FVB/NJ one-cell embryos. Maintained co-isogenic by backcross to FVB/NJ or intercross within closed colony.
Suggested Control Mice
Wild-type littermates
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@ucdavis.edu. Older strains may not have this information.
Donor
Bruce Hamilton, Ph.D., University of California, San Diego - School of Medicine.
Primary Reference

Chaki M, Airik R, Ghosh AK, Giles RH, Chen R, Slaats GG, Wang H, Hurd TW, ZhouW, Cluckey A, Gee HY, Ramaswami G, Hong CJ, Hamilton BA, Cervenka I, Ganji RS,Bryja V, Arts HH, van Reeuwijk J, Oud MM, Letteboer SJ, Roepman R, Husson H,Ibraghimov-Beskrovnaya O, Yasunaga T, Walz G, Eley L, Sayer JA, Schermer B,Liebau MC, Benzing T, Le Corre S, Drummond I, Janssen S, Allen SJ, Natarajan S,O'Toole JF, Attanasio M, Saunier S, Antignac C, Koenekoop RK, Ren H, Lopez I,Nayir A, Stoetzel C, Dollfus H, Massoudi R, Gleeson JG, Andreoli SP, Doherty DG, Lindstrad A, Golzio C, Katsanis N, Pape L, Abboud EB, Al-Rajhi AA, Lewis RA,Omran H, Lee EY, Wang S, Sekiguchi JM, Saunders R, Johnson CA, Garner E, VanselowK, Andersen JS, Shlomai J, Nurnberg G, Nurnberg P, Levy S, Smogorzewska A, OttoEA, Hildebrandt F. Exome capture reveals ZNF423 and CEP164 mutations, linkingrenal ciliopathies to DNA damage response signaling. Cell. 2012 Aug3;150(3):533-48. doi: 10.1016/j.cell.2012.06.028. (Medline PMID: 22863007)

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@ucdavis.edu.
Coat Color
White
MMRRC Breeding System
Backcross and sib-mating
Generation
N4 (FVB/NJ), F1
Bred to Homozygosity
No

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@ucdavis.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
051011-UCD-RESUS Litter recovered from cryo-archive $4,044.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@ucdavis.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.