Loading Mouse GIF
Loading...

Strain Name:
B6J.Cg-Lynx1tm1Htz Lypd1tm1.1Tmj/Mmucd
Stock Number:
051057-UCD
Citation ID:
RRID:MMRRC_051057-UCD
Other Names:
lynx1KO

Strain Information

Lynx1tm1Htz
Name: Ly6/neurotoxin 1; targeted mutation 1, Nathaniel Heintz
Synonyms: Lynx1-
Type: Allele
Species: Mus musculus (mouse)
Chromosome: 15
Alteration at locus: Knockout
Lypd1tm1.1Tmj
Name: Ly6/Plaur domain containing 1; targeted mutation 1.1, Thomas M Jessell
Synonyms: Lynx2-
Type: Allele
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: Knockout
Lypd1
Name: Ly6/Plaur domain containing 1
Synonyms: C530008O16Rik, 2700050C12Rik, Lynx2
Type: Gene
Species: Mouse
Chromosome: 1
Alteration at locus: Knockout
NCBI: 72585
Homologene: 16937
Lynx1
Name: Ly6/neurotoxin 1
Type: Gene
Species: Mouse
Chromosome: 15
Alteration at locus: Knockout
NCBI: 23936
Homologene: 8026
Genetic Alterations
Double knockout of Lynx1 and Lypd1 (a.k.a. Lynx2)
ES Cell Line
Allele #1: Bruce4
Allele #2: unknown
Phenotype
Lynx1 KO: Augmented associative learning (PMID:16950157), extended critical period plasticity in the visual cortex in adult mice (PMID:21071629), and altered synaptic signaling in the auditory cortex (PMID:29358666).
Lynx2 KO: Higher levels of anxiety-like behavior and social avoidance (PMID:19246390).

These two strains have been crossed together.
Mammalian Phenotype Terms
Allelic Composition: (Genetic Background: )

Allelic Composition: (Genetic Background: )

MeSH Terms
  • Age Factors
  • Animals
  • Association Learning/drug effects
  • Association Learning/physiology
  • Brain/drug effects
  • Brain/metabolism
  • Brain/pathology
  • Cell Survival/drug effects
  • Cell Survival/physiology
  • Excitatory Amino Acid Agonists/pharmacology
  • Membrane Glycoproteins/drug effects
  • Membrane Glycoproteins/genetics
  • Membrane Glycoproteins/metabolism
  • Membrane Potentials/drug effects
  • Membrane Potentials/physiology
  • Mice
  • Mice, Mutant Strains
  • Mutation
  • Nerve Degeneration/metabolism
  • Nerve Degeneration/pathology
  • Neurons/drug effects
  • Neurons/metabolism
  • Neurons/pathology
  • Neuropeptides/drug effects
  • Neuropeptides/genetics
  • Neuropeptides/metabolism
  • Nicotine/pharmacology
  • Nicotinic Agonists/pharmacology
  • Patch-Clamp Techniques
  • Receptors, Nicotinic/drug effects
  • Receptors, Nicotinic/metabolism
  • Anxiety
  • Anxiety Disorders/etiology
  • Behavior, Animal
  • Glutamic Acid
  • Membrane Glycoproteins/physiology
  • Neuropeptides/physiology
  • Protein Binding
  • Synaptic Transmission
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
  • Models for Human Disease
  • Neurobiology
Donor
Julie Miwa, Ph.D., Lehigh University.
Thomas Jessell, Ph.D., Columbia University.
Nathaniel Heintz, Ph.D., The Rockefeller University.
Primary Reference

Miwa JM, Stevens TR, King SL, Caldarone BJ, Ibanez-Tallon I, Xiao C, Fitzsimonds RM, Pavlides C, Lester HA, Picciotto MR, Heintz N. The prototoxinlynx1 acts on nicotinic acetylcholine receptors to balance neuronal activity and survival in vivo. Neuron. 2006 Sep 7;51(5):587-600. (Medline PMID: 16950157)

Tekinay AB, Nong Y, Miwa JM, Lieberam I, Ibanez-Tallon I, Greengard P, Heintz N. A role for LYNX2 in anxiety-related behavior. Proc Natl Acad Sci U S A. 2009Mar 17;106(11):4477-82. doi: 10.1073/pnas.0813109106. Epub 2009 Feb 25. (Medline PMID: 19246390)

Strain Development
A 9-kb HindIII/Lynx1 fragment was shotgun-subcloned from Lynx1 BAC26-1 (PMID:10811905) into the pBluescriptKS+ vector. Gene-specific primers, GCTGCTGACCTCCTATTCAC TCTGGCACTG CCCTCACGTC ACGCGTTCTG CAAACCCTATGCTACTCCGTCG and GCTGGGACCA GGGCCAAGGT CACCGGGGTAGCAAAGCCAG CAATATTCAT ATGTCCCGGC GGATTTGTCC TACTCAGGAGAGCG were used to PCR-amplify from FRT-neo-recA plasmid and the resulting PCR product was electroporated into 322EC cells, containing the 9-kb Lynx1 HindIII pKS+ construct. The modification was carried out using a bacterial recombination method (PMID:10811905). The targeting construct was electroporated into 129X1/SvJ embryonic stem (ES) cells, which were injected into blastocysts and implanted into pseudopregnant females. Three chimeric founders were crossed to C57BL/6J mice to produce F1 Lynx1 +/- mice and intercrossed to produce homozygous KO mice, as well as crossed to C57BL/6J mice to be maintained on a backcross (N12+).


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@ucdavis.edu.
Coat Color
Black
Eye
Black
MMRRC Breeding System
Backcross
Generation
N12+ (C57BL/6J)
Overall Breeding Performance
Poor
Viability and Fertility: Female Male Comments
Homozygotes are viable: Yes Yes
Homozygotes are fertile: Yes Yes
Heterozygotes are fertile: Yes Yes
Age Reproductive Decline: 4 to 6 months 8 to 12 months
Bred to Homozygosity
Yes
Average litter size
4-6
Recommended wean age
3 Weeks
Average Pups Weaned
4-6

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@ucdavis.edu for more information.

The donor or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
051057-UCD-EMBRYO Cryo-preserved embryos $1,038.00 / Non-Profit Aliquot Approximate quantity2 : 20-40 embryos / aliquot
051057-UCD-SPERM Cryo-preserved spermatozoa $546.25 / Non-Profit Aliquot Approximate quantity3
051057-UCD-RESUS Litter recovered from cryo-archive $5,892.91 / Non-Profit Litter Recovered litter4; additional fees for any special requests.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.