Loading Mouse GIF
Loading...

Strain Name:
C57BL/6N-Calm1em1(M77Q)Gkim/Mmjax
Stock Number:
065273-JAX
Citation ID:
RRID:MMRRC_065273-JAX
Other Names:
C57BL/6NJtm/Calm1KI

Strain Information

Calm1em1(M77Q)Gkim
Name: Calmodulin-1; endonuclease-mediated mutation 1, Geum Soo Kim
Type: Allele
Species: Mus musculus (mouse)
Chromosome:
Genetic Alterations
CRISPR/Cas9-mediated mutation predicting substitution of methionine-77 (Met77) with a glutamine in calmodulin-1 isoform 2 (Accession number AK151992, RefSeq NM_009790.5). Additional detail is provided in the Development section below.

HGVS nomenclature:
  • Genbank RefSeq - mRNA: NM_009790.5
  • Genbank RefSeq, protein: NP_033920.1
  • Variant, nucleic acid level: c.229_230delinsCA
  • Variant, amino acid level, predicted: p.Met77Gln
    Check this variant: LUMC Mutalyzer
    Note: The mutagenesis also introduced a silent mutation, c.258_261delinsTCGG, that should leave the amino acid sequence unaltered (p.=, see LUMC Mutalyzer)

Note HGVS nomenclature commonly references the longest known transcript, which is isoform 1 per NCBI. In the case of Calm1, the physiological relevance of this longest transcript is uncertain:
  • Genbank RefSeq - mRNA: NM_001313934.1
  • Genbank RefSeq, protein: NP_001300863.1
  • Variant, nucleic acid level: c.373_374delinsCA or c.373_375_delinsCAA
  • Variant, amino acid level, predicted: p.Met125Gln
    Check this variant: LUMC Mutalyzer
Phenotype
Unknown
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
  • Research Tools
Donor
Rodney L. Levine, National Heart, Lung, and Blood Institute.
Geumsoo Kim, National Heart, Lung, and Blood Institute (NHLBI), National Institutes of Health.
Primary Reference

Marimoutou M, Springer DA, Liu C, Kim G, Levine RL. Oxidation of Methionine 77in Calmodulin Alters Mouse Growth and Behavior. Antioxidants (Basel). 2018 Oct13;7(10). pii: E140. doi: 10.3390/antiox7100140. (Medline PMID: 30322141)

Strain Development
This knock-in mouse was created through CRISPR technique as follows: A ~200 bp genomic DNA sequence of Calm1 surrounding Met77 was submitted into MIT’s CRISPR design website. Two sgRNAs were selected based on their off-target scores and proximity to the mutation site, one upstream (Calm1-Upstream: CCCAGAGTTCTTGACTATGA) and the other downstream (Calm1-Downstream: CAAACACTCGGAAGGCCTCG) of the Met77. The Calm1-Upstream sgRNA was predicted to cut 14 bp upstream of Met77, the targeted mutation site. The Cam1-Downstream sgRNA was predicted to cut 34 bp downstream of Met77. The sgRNA binding sequences were cloned into a plasmid vector containing a T7 promoter using OriGene’s (Rockville, Maryland) sgRNA cloning service. These plasmids were then used as templates for generating sgRNAs using the MEGAshortscript T7 Kit (ThermoFisher). For each sgRNA, a corresponding oligonucleotide donor (Calm1-Upstream: ACTGTTTCTCTTCTCATTAAAGGCAATGGCACCATTGACTTCCCCGAGTTTCTGACTATGATGGCTAGAAAACAGAAAGACACAGATAGCGAAGAAGAGATCCGCGAGGCCTTCCGAGTG; and Calm1-Downstream: GGCACCATTGACTTCCCAGAGTTCTTGACTATGATGGCTAGAAAACAGAAAGACACAGATAGCGAAGAAGAGATTCGGGAGGCCTTCCGAGTGTTTGACAAGGTAATCTTGCACACTGGCCTT) was purchased from Integrated DNA Technologies (Skokie, Illinois), which contains not only the desired changes for mutating Met77 but also 2–3 silent mutations which do not result in any amino acid changes but can assist in preventing Cas9 from continuingly cutting the DNA after the donor is knocked in. Each sgRNA (50 ng/µL) and its corresponding donor oligonucleotides (100 ng/µL) were co-microinjected with Cas9 mRNA (100 ng/µL -Trilink BioTechnologies, San Diego, CA, USA) into the cytoplasm of zygotes collected from C57BL/6N mice. Injected embryos were cultured in M16 medium in a 37° incubator with 6% CO2. When embryos reached the 2-cell stage of development, they were implanted into the oviducts of pseudopregnant surrogate mothers. Offspring born to the foster mothers were genotyped by PCR and DNA sequencing for identifying founders with the desired nucleotide changes.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Cryo-recovered strains distributed by the MMRRC at JAX are shipped to the customer from the Pathogen & Opportunistic-Free Animal Room G200 - see https://www.jax.org/jax-mice-and-services/customer-support/customer-service/animal-health/health-status-reports.

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email csmmrrc@jax.org.
Coat Color
Black
Eye
Pink
MMRRC Breeding System
Random intra-strain mating
Overall Breeding Performance
Undetermined
Viability and Fertility: Female Male Comments
Homozygotes are viable: Yes Yes
Homozygotes are fertile: Yes Yes
Heterozygotes are fertile: Yes Yes
Age Reproductive Decline: Undetermined Greater than 12 months
Average litter size
4-6
Recommended wean age
3 Weeks
Average Pups Weaned
Greater than 15

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
065273-JAX-SPERM Cryo-preserved spermatozoa $459.00 / Non-Profit Aliquot Approximate quantity3
065273-JAX-RESUS Litter recovered from cryo-archive $2,123.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.