Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-Ppp1r3aem1Wex/Mmmh
Stock Number:
065351-MU
Citation ID:
RRID:MMRRC_065351-MU
Other Names:
PPP1R3A KO

Strain Information

Ppp1r3aem1Wex
Name: protein phosphatase 1, regulatory subunit 3A; endonuclease-mediated mutation 1, Xander Wehrens
Type: Allele
Species: Mus musculus (mouse)
Chromosome: 6
Alteration at locus: CRISPR
Ppp1r3a
Name: protein phosphatase 1, regulatory subunit 3A
Synonyms: GM, RGL
Type: Gene
Species: Mouse
Chromosome: 6
Alteration at locus: CRISPR
NCBI: 140491
HGNC: HGNC:9291
Homologene: 48124
Genetic Alterations
CRISPR/Cas9-mediated deletion of exons 2 and 3 of the mouse Ppp1r3a gene. Guide RNA design and production were performed by the Mouse Embryonic Stem Cell Core at Baylor College of Medicine. 5’-gRNA CTTTTCAGGTTTTAGTGATCTGG and 3’-gRNA GCTTGAGCCACAAGGCACTTTGG were selected using the Wellcome Trust Sanger Institute (WTSI) Genome Editing website (http://www.sanger.ac.uk/htgt/wge/). Additional detail in the Development section.
Genotype Determination
Phenotype
Homozygous: have higher susceptibility to pacing-induced cardiac arrhythmias and intracellular calcium handling defects in heart cells.
Strain Development
C57BL/6J female mice, 24 to 32 days old, were injected with 5 IU/mouse of pregnant mare serum, followed 46.5 hr later with 5 IU/mouse of human chorionic gonadotropin. The females were then mated to C57BL/6J males, and fertilized oocytes were collected at 0.5 dpc. Next, sgRNA (10ng/ul) and Cas9 mRNA (100 ng/ul) in RNAse-free 1xPBS were microinjected into the cytoplasm of 100 pronuclear stage zygotes. Injected zygotes were transferred into pseudo-pregnant ICR females on the afternoon of the injection, approximately 25-32 zygotes per recipient female. Founder animals harboring the desired deletion were identified with primers P1 5’-CAAAAGCAAAGCAATCTCAGG, P2 5’- CATAAGTCTTCAGTGGTGACACAG and P3 5’-CCTCACTCTTCCAGCCCTCT. PCR reactions were done separately for the endogenous wild-type (WT) allele (using primers P1 and P2, expected DNA band size 493bp) and the interval deletion knockout (KO) allele (using primers P1 and P3, expected DNA band size ~297 bp). One founder animal was selected for breeding to establish the knockout line. Sanger sequencing confirmed the interval deletion. WT, heterozygous (HET), and KO mice were identified with the same primers used for founder screening.
Suggested Control Mice
Wild-type littermates were identified by PCR genotyping as controls for all experiments.
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
  • Cardiovascular
  • Cell Biology
  • Models for Human Disease
Donor
Xander Wehrens, M.D., Baylor College of Medicine.
Primary Reference

Alsina KM, Hulsurkar M, Brandenburg S, Kownatzki-Danger D, Lenz C, Urlaub H,Abu-Taha I, Kamler M, Chiang DY, Lahiri SK, Reynolds JO, Quick AP, Scott L Jr,Word TA, Gelves MD, Heck AJR, Li N, Dobrev D, Lehnart SE, Wehrens XHT. Loss ofProtein Phosphatase 1 Regulatory Subunit PPP1R3A Promotes Atrial Fibrillation.Circulation. 2019 Aug 20;140(8):681-693. doi: 10.1161/CIRCULATIONAHA.119.039642. Epub 2019 Jun 12. (Medline PMID: 31185731)

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
Eye
Black
MMRRC Breeding System
Sib-mating
Generation
N2 (C57BL/6J), F11
Overall Breeding Performance
Good
Viability and Fertility: Female Male Comments
Homozygotes are viable: Yes Yes
Homozygotes are fertile: Yes Yes
Heterozygotes are fertile: Yes Yes
Age Reproductive Decline: 6 to 8 months Variable
Bred to Homozygosity
Yes
Average litter size
7-9
Recommended wean age
3 Weeks
Average Pups Weaned
5-9

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
065351-MU-SPERM Cryo-preserved spermatozoa $437.00 / $817.00
Non-Profit / For-Profit
Aliquot Approximate quantity3
065351-MU-RESUS Litter recovered from cryo-archive $2,624.00 / $5,340.00
Non-Profit / For-Profit
Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.