Strain Name:
B6N.Cg-Trim72em1Mure/Mmnc
Stock Number:
065944-UNC
Citation ID:
RRID:MMRRC_065944-UNC
Other Names:
TRIM72 C144S

Strain Information

Trim72em1Mure
Name: tripartite motif-containing 72; endonuclease-mediated mutation 1, Elizbeth Murphy
Synonyms: TRIM72 C144S
Type: Allele
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: TALEN
Trim72
Name: tripartite motif-containing 72
Synonyms: MG53, mitsugumin 53
Type: Gene
Species: Mouse
Chromosome: 7
Alteration at locus: TALEN
NCBI: 434246
Homologene: 66924
Genetic Alterations
Induced G-to-C mutation that replaces cysteine-144 with a serine (C144S).

HGVS nomenclature

Genotype Determination
  • Genotyping Protocol(s)
  • Center protocol and contact for technical support will be shipped with mice.
  • Phenotype
    None/Normal/Wild-type.

    This mouse is a research tool to study the modification of cysteine 144 in TRIM72 in vivo. TRIM72 plays an important role in the heart and muscle, regulating the development of insulin resistance, diabetes, cardiac hypertrophy, and ischemia/reperfusion injury.
    Strain Development
    TALEN mRNAs were co-microinjected with donor oligos into the cytoplasm of zygotes (from B6CBAF1/J mice). The sequence for the donor oligos was as follows:

    5'-ATCATCTCTTTTAATTTGTCCCATAGACACAGCTTCCACAACAAAAGATGCAGCTGCAGGAGGCATCCATGCGCAAAGAGAAGACTGTAGCGGTGCTGGAGCATCAGCTGGTGGAGGTG-3'

    Microinjected zygotes were cultured overnight in M16 medium. Embryos at the 2-cell stage of development were implanted into the oviducts of pseudopregnant foster mothers. PCR and Sanger sequencing were used to identify the genotype of the offspring. Founder mice were subsequently backcrossed to the C57BL/6N background over 10 generations.
    Suggested Control Mice
    Wild-type
    MMRRC Genetic QC Summary
    The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@med.unc.edu. Older strains may not have this information.
    • Apoptosis
    • Cardiovascular
    • Cell Biology
    • Diabetes
    • Metabolism
    • Research Tools
    Donor
    Elizbeth L. Murphy, Ph.D., National Institutes of Health (NIH), NHLBI.
    Primary Reference

    Fillmore N, Casin KM, Sinha P, Sun J, Ma H, Boylston J, Noguchi A, Liu C, WangN, Zhou G, Kohr MJ, Murphy E. A knock-in mutation at cysteine 144 of TRIM72 iscardioprotective and reduces myocardial TRIM72 release. J Mol Cell Cardiol. 2019 Sep 16. pii: S0022-2828(19)30190-7. doi: 10.1016/j.yjmcc.2019.09.008. [Epub aheadof print] (Medline PMID: 31536744)

    Colony and Husbandry Information

    Colony Surveillance Program and Current Health Reports

    Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc_health@med.unc.edu.
    Coat Color
    Black
    Eye
    Black
    MMRRC Breeding System
    Backcross
    Generation
    N10 (C57BL/6N)
    Overall Breeding Performance
    Excellent
    Viability and Fertility: Female Male Comments
    Homozygotes are viable: Yes Yes
    Homozygotes are fertile: Yes Yes
    Heterozygotes are fertile: Yes Yes
    Age Reproductive Decline: Undetermined Undetermined
    Average litter size
    4 to 6
    Recommended wean age
    3 Weeks
    Average Pups Weaned
    4 to 6

    Order Request Information

    Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

    Cryopreserved material may be available upon request, please inquire to mmrrc@med.unc.edu for more information.

    Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

    The donor or their institution limits the distribution to non-profit institutions only.

    Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

    Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
    MMRRC Item # Description Distribution Fee / Unit (US $)
    *Shipping & Handling not included*
    Units Notes
    065944-UNC-SPERM Cryo-preserved spermatozoa $564.00 / Non-Profit Aliquot Approximate quantity3
    065944-UNC-RESUS Litter recovered from cryo-archive $2,914.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
    Cryopreserved material may be available upon request, please inquire to mmrrc@med.unc.edu for more information.

    1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

    2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

    3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

    4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

    To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.