Register New MMRRC Account
Reset Password
Register for New Mouse Models
Click Here for Additional Contact Information
Availability & Fees Order this Strain
The 13-aa cortical granule localizing motif is encoded by exons 2 and 3 of the endogenous Astl gene. To avoid disruption of RNA splicing, the donor elected to delete the first 7 aa (52-DKDIPAI-58; numbers indicate the aa position) encoded entirely by exon 2 with a protospacer adjacent motif (PAM) sequence targeted by CRISPR/Cas9. To delete DNA encoding 52-DKDIPAI-58 at the endogenous Astl locus, Cas9 cRNA, sgRNA, and HDR (homology-directed repair) oligonucleotides were injected into zygotes, cultured to blastocysts, and transferred to uteri of pseudopregnant foster mothers. Of seven pups screened by PCR, two had bi-allelic mutations that were confirmed by DNA sequence. In each line, the CRISPR/Cas9 mutation had been modified by homology-directed repair to produce the desired deletion on one of the two endogenous alleles.
Additional detail: pMLM3613 (Addgene #42251) expressing Cas9 was linearized by PmeI, purified, and in vitro-transcribed. Double-stranded synthetic DNA targeting exon 2 of Astl (5’- GGACATCCCCGCAATTAACCAAGG-3’) was cloned into the pair of BsaI sites of pDR274 (Addgene #42250) expressing sgRNA. After linearization with DraI, the plasmid was purified and in vitro-transcribed. Cas9 cRNA (50 ng/μl), sgRNA (20 ng/μl), and donor oligo (5’-TCTGGAGTCTGCAGTACCAGTGTTCCAGAAGGCTTCACTCCTGA GGGAAGCCCGGTATTTCAGAACCAAGGTGAGAACACGGGGCCACACTCCAAAGC CATGCTGAATGTGGACATGCGGAAAAGA-3’, 20 ng/μl) were injected into B6D2F1 zygotes, which were transferred into pseudopregnant CD1 female mice. Genotyping used PCR with a primer that bridged the deleted sequence. Subsequent sib-mating to F7.
Xiong B, Zhao Y, Beall S, Sadusky AB, Dean J. A Unique Egg Cortical GranuleLocalization Motif Is Required for Ovastacin Sequestration to Prevent PrematureZP2 Cleavage and Ensure Female Fertility in Mice. PLoS Genet. 2017 Jan23;13(1):e1006580. doi: 10.1371/journal.pgen.1006580. eCollection 2017 Jan.(Medline PMID: 28114310)
Colony Surveillance Program and Current Health Reports
Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.
Cryopreserved material may be available upon request, please inquire to mmrrc@med.unc.edu for more information.
The donor or their institution limits the distribution to non-profit institutions only.
Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.
Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.
Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.
1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.
2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.
3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.
4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.