Loading Mouse GIF
Loading...

Strain Name:
B6;D2-Astlem1Dean/Mmnc
Stock Number:
066523-UNC
Citation ID:
RRID:MMRRC_066523-UNC
Other Names:
Astl cp(6) {Astl (∆/∆) }.

Strain Information

Astlem1Dean
Name: astacin like metalloendopeptidase; endonuclease-mediated mutation 1, Jurrien Dean
Synonyms: Astldelta
Type: Allele
Species: Mus musculus (mouse)
Chromosome: 2
Alteration at locus: CRISPR
Astl
Name: astacin like metalloendopeptidase
Synonyms: C87576, Ovastacin, Sas1b
Type: Gene
Species: Mouse
Chromosome: 2
Alteration at locus: CRISPR
NCBI: 215095
Homologene: 128191
Genetic Alterations
Deletion of the first 7 amino acids (52-DKDIPAI-58) by CRISPR/Cas9 at the endogenous locus.

HGVS nomenclature:
Genotype Determination
  • Genotyping Protocol(s)
  • Center protocol and contact for technical support will be shipped with mice.
  • Phenotype
    The misdirected enzyme is present within the endomembrane system and ZP2 is prematurely cleaved. Sperm bind poorly to the zona pellucida of AstlΔ/Δ mice with partially cleaved ZP2 and female mice are sub-fertile. Male mice (∆/∆) breed normal, females (∆/∆) are sterile.
    MeSH Terms
    • Animals
    • Cytoplasmic Granules/metabolism
    • Female
    • Fertilization
    • Metalloproteases/chemistry
    • Metalloproteases/genetics
    • Metalloproteases/metabolism
    • Mice
    • Oocytes/metabolism
    • Protein Sorting Signals
    • Protein Transport
    • Proteolysis
    • Zona Pellucida Glycoproteins/metabolism
    Strain Development

    The 13-aa cortical granule localizing motif is encoded by exons 2 and 3 of the endogenous Astl gene. To avoid disruption of RNA splicing, the donor elected to delete the first 7 aa (52-DKDIPAI-58; numbers indicate the aa position) encoded entirely by exon 2 with a protospacer adjacent motif (PAM) sequence targeted by CRISPR/Cas9. To delete DNA encoding 52-DKDIPAI-58 at the endogenous Astl locus, Cas9 cRNA, sgRNA, and HDR (homology-directed repair) oligonucleotides were injected into zygotes, cultured to blastocysts, and transferred to uteri of pseudopregnant foster mothers. Of seven pups screened by PCR, two had bi-allelic mutations that were confirmed by DNA sequence. In each line, the CRISPR/Cas9 mutation had been modified by homology-directed repair to produce the desired deletion on one of the two endogenous alleles.

    Additional detail: pMLM3613 (Addgene #42251) expressing Cas9 was linearized by PmeI, purified, and in vitro-transcribed. Double-stranded synthetic DNA targeting exon 2 of Astl (5’- GGACATCCCCGCAATTAACCAAGG-3’) was cloned into the pair of BsaI sites of pDR274 (Addgene #42250) expressing sgRNA. After linearization with DraI, the plasmid was purified and in vitro-transcribed. Cas9 cRNA (50 ng/μl), sgRNA (20 ng/μl), and donor oligo (5’-TCTGGAGTCTGCAGTACCAGTGTTCCAGAAGGCTTCACTCCTGA GGGAAGCCCGGTATTTCAGAACCAAGGTGAGAACACGGGGCCACACTCCAAAGC CATGCTGAATGTGGACATGCGGAAAAGA-3’, 20 ng/μl) were injected into B6D2F1 zygotes, which were transferred into pseudopregnant CD1 female mice. Genotyping used PCR with a primer that bridged the deleted sequence. Subsequent sib-mating to F7.

    Suggested Control Mice
    Wild-type littermates
    MMRRC Genetic QC Summary
    The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@med.unc.edu. Older strains may not have this information.
    • Developmental Biology
    • Reproduction
    • Research Tools
    Donor
    Jurrien Dean, M.D., National Institute of Diabetes and Digestive and Kidney Diseases, National Institutes of Health.
    Primary Reference

    Xiong B, Zhao Y, Beall S, Sadusky AB, Dean J. A Unique Egg Cortical GranuleLocalization Motif Is Required for Ovastacin Sequestration to Prevent PrematureZP2 Cleavage and Ensure Female Fertility in Mice. PLoS Genet. 2017 Jan23;13(1):e1006580. doi: 10.1371/journal.pgen.1006580. eCollection 2017 Jan.(Medline PMID: 28114310)

    Colony and Husbandry Information

    Colony Surveillance Program and Current Health Reports

    Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc_health@med.unc.edu.
    Coat Color
    Dark brown
    Eye
    Pink
    MMRRC Breeding System
    Sib-mating
    Generation
    F7
    Overall Breeding Performance
    Good
    NOTE: "Hemizygote" as used here refers to males carrying a mutation on the X Chromosome or mice of either sex carrying an inserted transgene with no homologous allele on the other chromosome.
    Viability and Fertility: Female Male Comments
    Homozygotes are viable: Reduced Yes
    Homozygotes are fertile: Reduced Yes
    Hetero/Hemizygotes are fertile: Reduced Yes
    Age Reproductive Decline: Less than 4 months 4 to 6 months
    Average litter size
    4 to 6
    Recommended wean age
    3 Weeks
    Average Pups Weaned
    4 to 6

    Order Request Information

    Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

    Cryopreserved material may be available upon request, please inquire to mmrrc@med.unc.edu for more information.

    The donor or their institution limits the distribution to non-profit institutions only.

    Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

    Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

    Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
    MMRRC Item # Description Distribution Fee / Unit (US $)
    *Shipping & Handling not included*
    Units Notes
    066523-UNC-RESUS Litter recovered from cryo-archive $3,242.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
    Cryopreserved material may be available upon request, please inquire to mmrrc@med.unc.edu for more information.

    Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

    1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

    2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

    3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

    4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

    To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.