Loading Mouse GIF
Loading...

Strain Name:
C57BL/6NCrl-Btnl4em1(IMPC)Tcp/CmmrMmucd
Stock Number:
066547-UCD
Citation ID:
RRID:MMRRC_066547-UCD
Other Names:
ADNJ
Major Collection:

Strain Information

QUALITY CONTROL OF C57BL/6NCrl-Btnl4em1(IMPC)Tcp/CmmrMmucd  |  University of California at Davis
Last Updated:
Strain Data and Information Information by Submitter Assessed by MMRRC1,2
Published Provided
Allele-specific genotype3 n.d.
Genetic background n.d.
Viability of genotypes available for distribution n.d.
Specific Pathogen- Status n.d.
Recoverability of cryopreserved sperm/embryos4 n.d.
Gene or allele sequence3 n.d.
Gene or allele expression3 n.d.
Gene or allele function3 n.d.
Observable and/or measurable phenotypes n.d.
Fertility of genotypes available for distribution n.d.
Fecundity/breeding performance n.d.

1 When indicated as verified ("YES"), then please note that information presented is to the best of our knowledge correct and up-to-date at the time of verification at the MMRRC Distribution Center; however, this information is subject to change due to breeding, maintenance, and other actions on the mouse strain at the MMRRC Distribution Center; direct any questions on this table to the MMRRC Distribution Center for this mouse stain.

2 If verification has not been performed (as indicated by "NO"), investigators may request specific verification testing for a fee. Requests should be submitted directly to the MMRRC Distribution Center assigned to the management, archiving, and distribution of the strain. A full listing of available testing and analytical services is available at https://www.mmrrc.org/about/services.php.

3 This information may or may not apply to each individual engineered allele (e.g., Cre, FlpO) present in the strain.

4 Recovery refers to thawing, in vitro fertilization (IVF), and/or embryo culture leading to live offspring.

Btnl4em1(IMPC)Tcp
Name: butyrophilin-like 4; endonuclease-mediated mutation 1, The Centre for Phenogenomics
Type: Allele
Species: Mus musculus (mouse)
Chromosome: 17
Alteration at locus: CRISPR
Btnl4
Name: butyrophilin-like 4
Synonyms: NG11, EG632126, Btn3a3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 632126
Homologene: 106849
Genetic Alterations
This allele from projects TCPR0881 and TCPR0882 was generated at The Centre for Phenogenomics by injecting Cas9 endonuclease and two guide RNAs with spacer sequences of GCAAGGAGTGTTCTATGATG targeting the 5' side and GGAGCATTCTGCAAGGCTGA targeting the 3' side of exons ENSMUSE00000141100 and ENSMUSE00000456939 resulting in a 1372-bp deletion of Chr17 from 34472676 to 34474047 (GRCm38). This mutation is predicted to cause a frameshift with the amino acid changes after residue 131 and early truncation 10 amino acids later (p.Q131Hfs*12).
Phenotype
Phenotyping data may be available at mousephenotype.org.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Lauryl Nutter, Ph.D., The Hospital for Sick Children.
Strain Development
Cas9 components were microinjected or electroporated into C57BL/6NCrl zygotes and progeny were screened for the desired mutation. Founders were mated to C57BL/6NCrl mice, and derived N1 progeny were identified by PCR and/or sequencing and subjected to quality control including allele sequencing. N1 mice passing QC were then backcrossed to C57BL/6NCrl mice to generate N2 mice identified by PCR. Mutant mice backcrossed at least 2 generations (N2 or more) were intercrossed to produce cohorts for phenotyping. Backcrossed (N2 or more) or intercrossed (N2F1 or more) heterozygous mice were used for cryopreservation.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@ucdavis.edu.
Coat Color
Black
MMRRC Breeding System
Backcross or Sib-Mating
Overall Breeding Performance
Good
Viability and Fertility: Female Male Comments
Homozygotes are viable: Yes Yes
Homozygotes are fertile: Yes Yes
Heterozygotes are fertile: Yes Yes
Age Reproductive Decline: Unknown Unknown

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
066547-UCD-RESUS Litter recovered from cryo-archive $7,366.14 / Non-Profit Litter Recovered litter4; additional fees for any special requests.

Some MMRRC strains were submitted by the submitter as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.