Strain Name:
C57BL/6NCrl-Dnah9em1(IMPC)Tcp/TcpMmucd
Stock Number:
066696-UCD
Citation ID:
RRID:MMRRC_066696-UCD
Other Names:
ADTV
Major Collection:

Strain Information

Dnah9em1(IMPC)Tcp
Name: dynein, axonemal, heavy chain 9; endonuclease-mediated mutation 1, The Centre for Phenogenomics
Type: Allele
Species: Mus musculus (mouse)
Chromosome: 11
Alteration at locus: CRISPR
Dnah9
Name: dynein, axonemal, heavy chain 9
Synonyms: Dnahc9, D11Ertd686e
Type: Gene
Species: Mouse
Chromosome: 11
Alteration at locus: CRISPR
NCBI: 237806
HGNC: HGNC:2953
Homologene: 20357
Genetic Alterations
This allele from project TCPR1050 was generated at The Centre for Phenogenomics by electroporating Cas9 ribonucleoprotein complexes with single guide RNAs having spacer sequences of TCTGGTCACAGCAGTGTCGC and ATGTCTGAGTTCGGTTCTTG targeting the 5' side and AAGCAGGTGAGGACCCGTAA and GGTGGCAGGAATAGCAAATC targeting the 3' side of a critical exon. This resulted in a 272-bp deletion of Chr11 from 66155405 to 66155676 (GRCm38).
Phenotype
Phenotyping data may be available at mousephenotype.org.
Strain Development
Cas9 components were microinjected or electroporated into C57BL/6NCrl zygotes and progeny were screened for the desired mutation. Founders were mated to C57BL/6NCrl mice, and derived N1 progeny were identified by PCR and/or sequencing and subjected to quality control including allele sequencing. N1 mice passing QC were then backcrossed to C57BL/6NCrl mice to generate N2 mice identified by PCR. Mutant mice backcrossed at least 2 generations (N2 or more) were intercrossed to produce cohorts for phenotyping. Backcrossed (N2 or more) or intercrossed (N2F1 or more) heterozygous mice were used for cryopreservation.
Suggested Control Mice
wild-type from colony
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@ucdavis.edu. Older strains may not have this information.
Donor
Lauryl Nutter, Ph.D., The Toronto Centre for Phenogenomics.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@ucdavis.edu.

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@ucdavis.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
066696-UCD-RESUS Litter recovered from cryo-archive $5,055.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@ucdavis.edu for more information.

Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.