Register New MMRRC Account
Reset Password
Register for New Mouse Models
Click Here for Additional Contact Information
Availability & Fees Order this Strain
The CRISPR system was used to cut at a desired location and cause non-specific mutations with non-homologous end-joining. Only mice with nonsense mutations were created. The sgRNAs targeting Gtf2i and Gtf2ird1 were:
CRISPR targeted mutagenesis of Gtf2i resulted in a 2-bp deletion in exon 5 of Gtf2i, introducing a premature stop codon and non-sense mediated decay. There is a 100% reduction in protein level in knockout animals (E13.5 brain). Gt2ird1 targeting resulted in a 589-bp deletion in exon 3, leaving only the first 14 bp of exon 3 and introducing a frameshift. This allele in cis with the above Gtf2i mutation.
HGVS nomenclature:
This line was generated by simultaneously injecting sgRNAs targeting exon 5 of Gtf2i and exon 3 of Gtf2ird1 along with Cas9 mRNA into the eggs of FVB/NJ animals. (sgRNAs: Gtf2i: TTAATACGACTCACTATAGGGGGTTGCGAGGTCGTAATGTTC, Gtf2ird1: TTAATACGACTCACTATAGGGGCTCATTGTGTACCGCCACGC). The animals were crossed minimally five times to FVB.129P2-Pde6b+ Tyrc-ch/Ant (a.k.a. "sighted FVB"; JAX Strain #004828) until they were completely on the FVB.129P2 background. The mutations were detected by deep sequencing of the Gtf2i exon 5 and the amplicon of mm10 coordinates chr5:134,413,981-134,417,246 of Gtf2ird1. This revealed a 2-bp deletion in exon 5 of Gtf2i and a 589-bp deletion in Gtf2ird1 that removed all but the first 14 bp of exon 3. Both mutations are on the same chromosome and are inherited together. The line was maintained on JAX Strain #004828 until donation to the MMRRC.
Wild-type littermates; FVB.129P2-Pde6b+ Tyrc-ch/Ant (a.k.a. "sighted FVB"; JAX Strain #004828)
Available at https://doi.org/10.1101/854851
Cryo-recovered strains distributed by the MMRRC at JAX are shipped to the customer from the Pathogen & Opportunistic-Free Animal Room G200 - see https://www.jax.org/jax-mice-and-services/customer-support/customer-service/animal-health/health-status-reports.
N5 (FVB.129P2-Pde6b+ Tyrc-ch/Ant, a.k.a. "sighted FVB"; JAX Strain #004828)
Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.
Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information.
The donor or their institution limits the distribution to non-profit institutions only.
Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.
Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.
1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.
2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.
3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.
4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.