Loading Mouse GIF
Loading...

Strain Name:
FVB(129P2)-Pde6b+ Gtf2ird1em3Jdd Tyrc-ch/Mmjax
Stock Number:
066711-JAX
Citation ID:
RRID:MMRRC_066711-JAX
Other Names:
Gtf2ird1+/-, FVB.129P2- Gtf2ird1em1bpinsJDD

Strain Information

Gtf2ird1em3Jdd
Name: general transcription factor II I repeat domain-containing 1; endonuclease-mediated mutation 3, Joseph D Dougherty
Synonyms: Gtf2ird1em1bpins
Type: Allele
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: CRISPR
Gtf2ird1
Name: general transcription factor II I repeat domain-containing 1
Synonyms: WBSCR11, Cream1, GTF3, MusTRD1, binding factor for early enhancer, BEN, ESTM9
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 57080
HGNC: HGNC:4661
Homologene: 4158
Pde6b+
Name: phosphodiesterase 6B, cGMP, rod receptor, beta polypeptide; wild-type allele
Type: Allele
Species: Mus musculus (mouse)
Chromosome: 5
Pde6b
Name: phosphodiesterase 6B, cGMP, rod receptor, beta polypeptide
Synonyms: rd, r, Pdeb, rd10, rd1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18587
HGNC: HGNC:8786
Homologene: 237
Tyrc-ch
Name: tyrosinase; chinchilla
Synonyms: cch, cr
Type: Allele
Species: Mus musculus (mouse)
Chromosome: 7
Alteration at locus: Spontaneous Mutation
Tyr
Name: tyrosinase
Synonyms: skc35, Oca1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22173
Homologene: 30969
Genetic Alterations
The CRISPR system was used to cut at a desired location and cause non-specific mutations with non-homologous end-joining. Only mice with nonsense mutations were created. The sgRNAs targeting Gtf2i and Gtf2ird1 were:
  • T7-gRNA-gtf2iex5b-For: TTAATACGACTCACTATAGGGGGTTGCGAGGTCGTAATGTTC
  • T7-gRNA-IRD1ex3-For: TTAATACGACTCACTATAGGGGCTCATTGTGTACCGCCACGC

CRISPR targeting of Gtf2i resulted in no discernible genetic alteration in the targeted gene. Gt2ird1 targeting resulted in 1-bp duplication in exon 3, resulting in N-terminally truncated Gtf2ird1 protein that cannot bind its own promoter.

HGVS nomenclature, Gtf2ird1 allele:

  • Genbank RefSeq - mRNA: NM_020331.3
  • Genbank RefSeq, protein: NP_065064.2
  • Variant, nucleic acid level: c.164dup
  • Variant, amino acid level, predicted: p.Ala56Glyfs*5
  • Check this variant: LUMC Mutalyzer
ES Cell Line
Not applicable
Phenotype
Homozygous: 40% reduction in Gtf2ird1 protein. The mutant Gtf2ird1 protein has an N-terminal truncation, eliminating binding to the Gtf2ird1 promoter. The animals are viable, have moderate deficits in balance, enhanced fear conditioning, altered marble-burying behavior, and show mild gene expression changes in the brain.
Mammalian Phenotype Terms
Allelic Composition: Tyrc-ch/Tyrc-ch (Genetic Background: involves: C57BL/6 )

Allelic Composition: Tyrc-ch/Tyrc-ch38H (Genetic Background: involves: 101/H * C3H/HeH )

Allelic Composition: Tyrc-42H/Tyrc-ch (Genetic Background: involves: 101/H * C3H/HeH )

Allelic Composition: Tyrc-43H/Tyrc-ch (Genetic Background: involves: 101/H * C3H/HeH )

Allelic Composition: Tyrc-112K/Tyrc-ch (Genetic Background: involves: 101/R1 * C3Hf/R1 * St.2A )

Allelic Composition: Tyrc-40H/Tyrc-ch (Genetic Background: involves: C3H/HeH )

Allelic Composition: Tyrc-a/Tyrc-ch (Genetic Background: involves: C3H/HeJ )

  • pigmentation
  • integument
Allelic Composition: Tyrcm1OR/Tyrc-ch (Genetic Background: involves: C3H/Rl )

Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
  • Models for Human Disease
  • Neurobiology
  • Research Tools
Donor
Joseph Dougherty, Ph.D., Washington University School of Medicine in St. Louis.
Primary Reference

Kopp ND, Nygaard KR, Liu Y, McCullough KB, Maloney SE, Gabel HW, Dougherty JD. Functions of Gtf2i and Gtf2ird1 in the developing brain: transcription, DNA binding and long-term behavioral consequences. Hum Mol Genet. 2020 Jun 3;29(9):1498-1519. doi: 10.1093/hmg/ddaa070. (Medline PMID: 32313931)

Strain Development

This line was generated by simultaneously injecting sgRNAs targeting exon 5 of Gtf2i and exon 3 of Gtf2ird1 along with Cas9 mRNA into the eggs of FVB/NJ animals. (sgRNAs: Gtf2i: TTAATACGACTCACTATAGGGGGTTGCGAGGTCGTAATGTTC, Gtf2ird1: TTAATACGACTCACTATAGGGGCTCATTGTGTACCGCCACGC). The animals were crossed minimally five times to FVB.129P2-Pde6b+ Tyrc-ch/Ant (a.k.a. "sighted FVB"; JAX Strain #004828) until they were completely on the FVB.129P2 background. The mutations were detected by deep sequencing of the Gtf2i exon 5 and the amplicon of mm10 coordinates chr5:134,413,981-134,417,246 of Gtf2ird1. No mutations were found in Gtf2i exon 5. However, Gtf2ird1 had a 1-bp duplication in exon 3 of Gtf2ird1. The line was maintained on JAX Strain #004828 until donation to the MMRRC.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Cryo-recovered strains distributed by the MMRRC at JAX are shipped to the customer from the Pathogen & Opportunistic-Free Animal Room G200 - see https://www.jax.org/jax-mice-and-services/customer-support/customer-service/animal-health/health-status-reports.

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email csmmrrc@jax.org.
Coat Color
Chinchilla
Eye
Black
MMRRC Breeding System
Backcross
Generation

N5 (FVB.129P2-Pde6b+ Tyrc-ch/Ant, a.k.a. "sighted FVB"; JAX Strain #004828)

Overall Breeding Performance
Good
Viability and Fertility: Female Male Comments
Homozygotes are viable: Yes Yes
Homozygotes are fertile: Yes Yes
Heterozygotes are fertile: Yes Yes
Age Reproductive Decline: Undetermined Undetermined
Bred to Homozygosity
Yes
Average litter size
Variable
Recommended wean age
3 Weeks
Average Pups Weaned
Variable

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information.

The submitter or their institution limits the distribution to non-profit institutions only.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
066711-JAX-EMBRYO Cryo-preserved embryos $1,090.00 / Non-Profit Aliquot Approximate quantity2 : 20-40 embryos / aliquot
066711-JAX-RESUS Litter recovered from cryo-archive $2,123.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.