Register New MMRRC Account
Reset Password
Register for New Mouse Models
Click Here for Additional Contact Information
Availability & Fees Order this Strain
CRISPR targeting of Gtf2i resulted in no discernible genetic alteration in the targeted gene. Gt2ird1 targeting resulted in 1-bp duplication in exon 3, resulting in N-terminally truncated Gtf2ird1 protein that cannot bind its own promoter.
HGVS nomenclature, Gtf2ird1 allele:
This line was generated by simultaneously injecting sgRNAs targeting exon 5 of Gtf2i and exon 3 of Gtf2ird1 along with Cas9 mRNA into the eggs of FVB/NJ animals. (sgRNAs: Gtf2i: TTAATACGACTCACTATAGGGGGTTGCGAGGTCGTAATGTTC, Gtf2ird1: TTAATACGACTCACTATAGGGGCTCATTGTGTACCGCCACGC). The animals were crossed minimally five times to FVB.129P2-Pde6b+ Tyrc-ch/Ant (a.k.a. "sighted FVB"; JAX Strain #004828) until they were completely on the FVB.129P2 background. The mutations were detected by deep sequencing of the Gtf2i exon 5 and the amplicon of mm10 coordinates chr5:134,413,981-134,417,246 of Gtf2ird1. No mutations were found in Gtf2i exon 5. However, Gtf2ird1 had a 1-bp duplication in exon 3 of Gtf2ird1. The line was maintained on JAX Strain #004828 until donation to the MMRRC.
Wild-type littermates; FVB.129P2-Pde6b+ Tyrc-ch/Ant (a.k.a. "sighted FVB"; JAX Strain #004828)
Kopp ND, Nygaard KR, Liu Y, McCullough KB, Maloney SE, Gabel HW, Dougherty JD. Functions of Gtf2i and Gtf2ird1 in the developing brain: transcription, DNA binding and long-term behavioral consequences. Hum Mol Genet. 2020 Jun 3;29(9):1498-1519. doi: 10.1093/hmg/ddaa070. (Medline PMID: 32313931)
Cryo-recovered strains distributed by the MMRRC at JAX are shipped to the customer from the Pathogen & Opportunistic-Free Animal Room G200 - see https://www.jax.org/jax-mice-and-services/customer-support/customer-service/animal-health/health-status-reports.
N5 (FVB.129P2-Pde6b+ Tyrc-ch/Ant, a.k.a. "sighted FVB"; JAX Strain #004828)
Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.
Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information.
The donor or their institution limits the distribution to non-profit institutions only.
Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.
Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.
1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.
2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.
3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.
4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.