Strain Name:
C57BL/6J-Lyplal1em1Espel/Mmmh
Stock Number:
066736-MU
Citation ID:
RRID:MMRRC_066736-MU
Other Names:
Lyplal1 em1Espel

Strain Information

Lyplal1em1Espel
Name: lysophospholipase-like 1; endonuclease-mediated mutation 1, Elizabeth Speliotes
Type: Allele
Species: Mus musculus (mouse)
Chromosome: 1
Alteration at locus: CRISPR
Lyplal1
Name: lysophospholipase-like 1
Synonyms: Q96AVO
Type: Gene
Species: Mouse
Chromosome: 1
Alteration at locus: CRISPR
NCBI: 226791
Homologene: 13683
Genetic Alterations

Single-base deletion in the first exon of Lyplal1 leading to a frameshift and early termination.

HGVS nomenclature:

  • Genbank RefSeq - mRNA: NM_146106
  • Genbank RefSeq, protein: NP_666218.2
  • Variant, nucleic acid level: c.33del
  • Variant, amino acid level, predicted: p.(Arg12Valfs*14)
    Check this variant: LUMC Mutalyzer
Phenotype
Female Lyplal1 KO mice on high-fat high sucrose diet show resistance to diet-induced fat gain and insulin resistance as well as decreased liver steatosis and damage.
Strain Development
CRISPR/Cas9 technology was used by the University of Michigan Transgenic Animal Model Core to generate a genetically modified C57BL6/J mouse strain with a one base pair deletion in the first exon of Lyplal1 referred to as Lyplal1 KO mice. Five single guide RNA (sgRNA) targets were identified for testing in exon 1 Ensembl.org exon id=ENSMUSE00000375205 with the algorithm described by Hsu and colleagues (PMID:23873081) and cloned into plasmid pX330 (Addgene plasmid #42230), as described (PMID:24157548). One sgRNA and protospacer adjacent motif (PAM) with the highest chromosome cleavage activity and a high specificity prediction was selected for generation of Lyplal1 KO mice: 5’ GGGACACCACACAACGCGGC 3’ PAM: AGG. Mouse zygote microinjection was carried out as described (DOI:10.1007/978-3-642-20792-1_6). Animals were housed in an AAALAC accredited facility in accordance with the National Research Council’s guide for the care and use of laboratory animals. Procedures were approved by the University of Michigan’s Institutional Animal Care & Use Committee. pX330 plasmid DNA expressing the active sgRNA was purified with an endotoxin-free kit. Plasmid DNA concentration was adjusted to 5 ng/ul for pronuclear microinjection. Mouse zygotes for microinjection were obtained by mating superovulated C57BL/6J females with males of the same strain (JAX Strain #000664). Mouse zygotes (457) were microinjected and those that survived injection (395) were transferred to pseudopregnant females. Genomic DNA was isolated from tail tip biopsies of 65 potential founders that were born and analyzed for CRISPR/Cas9 induced indels with CEL I endonuclease. A total of 26 G0 mouse pups (40%) were identified as carrying mutations in Lyplal1. The efficiency of the producing mutant mouse founders exceeded the efficiency of producing transgenic mice carrying random integrations of DNA transgenes by a factor of four.
Suggested Control Mice
C57BL/6J
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
  • Diabetes
  • Metabolism
  • Obesity
Donor
Elizabeth K. Speliotes, M.D., University of Michigan Medical School.
Brian Halligan, Ph.D., University of Michigan Medical School.
Primary Reference
In preparation, submitted, or in press

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
Eye
Black
MMRRC Breeding System
Backcross
Generation
N5+ (C57BL/6J)
Overall Breeding Performance
Good
Viability and Fertility: Female Male Comments
Homozygotes are viable: Yes Yes
Homozygotes are fertile: Yes Yes
Heterozygotes are fertile: Yes Yes
Age Reproductive Decline: 4 to 6 months 10 to 12 months
Average litter size
Variable
Recommended wean age
3 Weeks
Average Pups Weaned
Variable

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

A Commercial License Agreement from the Donor is required for for-profit entities to use this strain.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
066736-MU-SPERM Cryo-preserved spermatozoa $437.00 / $817.00
Non-Profit / For-Profit
Aliquot Approximate quantity3
066736-MU-RESUS Litter recovered from cryo-archive $2,624.00 / $5,340.00
Non-Profit / For-Profit
Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.