Strain Name:
C57BL/6NJ-Tmem212em1(IMPC)J/Mmjax
Stock Number:
066844-JAX
Citation ID:
RRID:MMRRC_066844-JAX
Major Collection:

Gene Information

Tmem212em1(IMPC)J
Name: transmembrane protein 212; endonuclease-mediated mutation 1, Jackson
Type: Allele
Species: Mus musculus (mouse)
Alteration at locus: CRISPR
Tmem212
Name: transmembrane protein 212
Synonyms: E030011K20Rik
Type: Gene
Species: Mus musculus (mouse)
Chromosome: 3
Alteration at locus: CRISPR
NCBI: 208613
Homologene: 28471
Genetic Alterations
intragenic deletion
Phenotype
Phenotyping data may be available at mousephenotype.org.
Strain Development
This allele was generated at The Jackson Laboratory by electroporating Cas9 protein and 2 guide sequences ACGTATGTAGAGGGCACAAC and TCGTGACCTAACAGGAGCGG, which resulted in a 2249 bp deletion plus a 1 base pair insertion (T) beginning at Chromosome 3 position 27,938,683 bp and ending after 27,940,931 bp (GRCm39/mm39). This mutation deletes ENSMUSE00000364670, ENSMUSE00000409111 (exons 2 and 3) and 1866 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 53 and early truncation 14 amino acids later.
Suggested Control Mice
C57BL/6NJ or wild-type from colony
Donor
Stephen Murray, Ph.D., The Jackson Laboratory.

Colony and Husbandry Information

For more information about this colony's health status contact csmmrrc@jax.org
Coat Color
Black
Generation
N2F2
Overall Breeding Performance
Undetermined
Viability and Fertility: Female Male Comments
Homozygotes are viable: Undetermined Undetermined Undetermined
Homozygotes are fertile: Undetermined Undetermined Undetermined
Heterozygotes are fertile: Undetermined Undetermined Undetermined
Age Reproductive Decline: Undetermined Undetermined
Average litter size
Undetermined
Average Pups Weaned
Undetermined

Order Request Information

When this strain becomes available, Limited quantities of breeder mice (up to 2 males and 2 females or 4 mice) per investigator per month are available from a live colony, usually available to ship in under 12 weeks. Larger quantities may be available, please contact the distributing center directly at csmmrrc@jax.org for more details.

Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

- Products for this strain are Not Yet Available for Ordering
- If you register interest in this strain, you will be notified when it becomes available for ordering.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.