Loading Mouse GIF
Loading...

Strain Name:
C57BL/6NTac-Gpr146em1(IMPC)H/Mmnc
Stock Number:
067251-UNC
Citation ID:
RRID:MMRRC_067251-UNC
Other Names:
Gpr146
Major Collection:

Strain Information

Gpr146em1(IMPC)H
Name: G protein-coupled receptor 146; endonuclease-mediated mutation 1, Harwell
Type: Allele
Species: Mus musculus (mouse)
Chromosome: 5
Alteration at locus: CRISPR
Gpr146
Name: G protein-coupled receptor 146
Synonyms: PGR8
Type: Gene
Species: Mouse
Chromosome: 5
Alteration at locus: CRISPR
NCBI: 80290
Homologene: 36472
Genetic Alterations
This allele from IMPC was generated at Medical Research Council Harwell by injecting CAS9 RNA and 2 guide sequences CGACGTGTACTTCGTGAACATGG, TCGTGAACATGGCCGTGGCGGGG, which resulted in a Indel.
Genotype Determination
  • Genotyping Protocol(s)
  • Center protocol and contact for technical support will be shipped with mice.
  • Phenotype
    Phenotyping data may be available at mousephenotype.org.
    Strain GQC Summary
    Gene Specific Genotyping:

    To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

    Background Genetic Quality:

    The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

    Suggested Control Mice
    Littermates of all relevant genotypes.
    Donor
    Martin Fray, Ph.D., MRC Harwell.
    Strain Development
    CRISPR guide(s) and Cas9 protein were microinjected into C57BL/6NTac zygotes and progeny were screened for the desired mutation. Founders were mated to C57BL/6NTac breeders, and derived N1 progeny were identified by PCR and/or sequencing. N1 were then mated again to C57BL/6NTac breeders, to generate N2 mice, identified by PCR and/or sequencing. N2 heterozygous mutant mice were used for cryopreservation purposes.


    Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

    Colony and Husbandry Information

    Colony Surveillance Program and Current Health Reports

    Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc_health@med.unc.edu.
    Coat Color
    Black
    MMRRC Breeding System
    Intra-strain
    Generation
    N2
    Overall Breeding Performance
    Undetermined
    Viability and Fertility: Female Male Comments
    Homozygotes are viable: Undetermined Undetermined
    Homozygotes are fertile: Undetermined Undetermined
    Heterozygotes are fertile: Yes Yes
    Age Reproductive Decline: Undetermined Undetermined
    Bred to Homozygosity
    No
    Average litter size
    Undetermined
    Recommended wean age
    3 weeks
    Average Pups Weaned
    Undetermined

    Order Information

    Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

    Cryopreserved material may be available upon request, please inquire to mmrrc@med.unc.edu for more information.

    Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

    The donor or their institution limits the distribution to non-profit institutions only.

    Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

    Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
    MMRRC Item # Description Distribution Fee / Unit (US $)
    *Shipping & Handling not included*
    Units Notes
    067251-UNC-RESUS Litter recovered from cryo-archive $3,242.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
    Cryopreserved material may be available upon request, please inquire to mmrrc@med.unc.edu for more information.

    Some MMRRC strains were submitted by the donor as cryopreserved germplasm, and because these strains were not cryopreserved by the MMRRC, we have not assessed the quality, nor genotype, of this material. Our expertise in reviving mice from various qualities of frozen sperm and embryos, using methods like IVF and ICSI, gives us confidence in successful recoveries in most cases. However, due to the uncertain quality of these samples, we'll limit revival attempts to two per order. Additional attempts are available for a fee, on top of standard charges, if requested. It's important to note that some strains may lack the expected mutation, so we can't assure successful order fulfillment until we attempt to revive the strain.

    1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

    2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

    3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

    4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

    To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.