Strain Name:
C57BL/6J-MtgxR8028Btlr/Mmmh
Stock Number:
067467-MU
Citation ID:
RRID:MMRRC_067467-MU
Other Names:
R8028 (G1)
Major Collection:

Strain Information

Swt1
Name: SWT1 RNA endoribonuclease homolog (S. cerevisiae)
Synonyms: 1200016B10Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 66875
Homologene: 32355
Arhgap21
Name: Rho GTPase activating protein 21
Synonyms: 5530401C11Rik, ARHGAP10
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71435
Homologene: 10822
Map4
Name: microtubule-associated protein 4
Synonyms: MAP 4, Mtap4
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17758
HGNC: HGNC:6862
Homologene: 1780
Stk38l
Name: serine/threonine kinase 38 like
Synonyms: Ndr2, 4930473A22Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232533
Homologene: 56299
Srrt
Name: serrate RNA effector molecule homolog (Arabidopsis)
Synonyms: Asr2, 2810019G02Rik, Ars2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 83701
Homologene: 9298
Rsf1
Name: remodeling and spacing factor 1
Synonyms: XAP8, Hbxap, p325, 4832420A03Rik, C030033M12Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233532
Homologene: 41142
Hif1a
Name: hypoxia inducible factor 1, alpha subunit
Synonyms: HIF-1alpha, HIF1alpha, MOP1, bHLHe78
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 15251
HGNC: HGNC:4910
Homologene: 1171
Kel
Name: Kell blood group
Synonyms: CD238
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 23925
HGNC: HGNC:6308
Homologene: 362
Tmem230
Name: transmembrane protein 230
Synonyms: 5730494N06Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 70612
Homologene: 8561
Abca3
Name: ATP-binding cassette, sub-family A member 3
Synonyms: Abc3, ABC-C, 1810036E22Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 27410
HGNC: HGNC:33
Homologene: 37437
Lama2
Name: laminin, alpha 2
Synonyms: merosin, mer
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16773
HGNC: HGNC:6482
Homologene: 37306
Clcn2
Name: chloride channel, voltage-sensitive 2
Synonyms: ClC-2, Clc2, nmf240
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 12724
HGNC: HGNC:2020
Homologene: 3213
Myh8
Name: myosin, heavy polypeptide 8, skeletal muscle, perinatal
Synonyms: 4832426G23Rik, Myhs-p, MyHC-pn, Myhsp
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17885
HGNC: HGNC:7578
Homologene: 68256
Polq
Name: polymerase (DNA directed), theta
Synonyms: A430110D14Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 77782
HGNC: HGNC:9186
Homologene: 32727
Gpr179
Name: G protein-coupled receptor 179
Synonyms: 5330439C02Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217143
Homologene: 34917
Arhgef11
Name: Rho guanine nucleotide exchange factor 11
Synonyms: Prg, PDZ-RhoGEF
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 213498
Homologene: 11409
Zscan12
Name: zinc finger and SCAN domain containing 12
Synonyms: Zfp96
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 22758
Homologene: 86980
Vmn2r98
Name: vomeronasal 2, receptor 98
Synonyms: EG224552
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224552
Homologene: 115024
Parl
Name: presenilin associated, rhomboid-like
Synonyms: Psarl, D16Ertd607e, PSARL1, PRO2207, PSENIP2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 381038
Homologene: 10239
Ccdc158
Name: coiled-coil domain containing 158
Synonyms: 4932413O14Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 320696
Homologene: 18560
Osbpl5
Name: oxysterol binding protein-like 5
Synonyms: Obph1, 1110006M06Rik, ORP5
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 79196
Homologene: 98024
Sardh
Name: sarcosine dehydrogenase
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 192166
Homologene: 5149
Sry
Name: sex determining region of Chr Y
Synonyms: Tdf, Tdy
Type: Gene
Species: Mouse
Chromosome: Y
NCBI: 21674
Pcdhb17
Name: protocadherin beta 17
Synonyms: Pcdhb16, PcdhbQ
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93888
Homologene: 81881
Kcna7
Name: potassium voltage-gated channel, shaker-related subfamily, member 7
Synonyms: Kv1.7
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16495
HGNC: HGNC:6226
Homologene: 7791
Poglut1
Name: protein O-glucosyltransferase 1
Synonyms: wsnp, Rumi, Ktelc1, 9630046K23Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224143
Homologene: 41353
Ccdc121
Name: coiled-coil domain containing 121
Synonyms: 4930548H24Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 67656
Gm20671
Name: predicted gene 20671
Type: Gene
Species: Mouse
Chromosome: 5
Gatad1
Name: GATA zinc finger domain containing 1
Synonyms: 2810047M21Rik, 9130430G15Rik, 2310031E19Rik, 8430439A17Rik, Odag, B330017N08Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 67210
Homologene: 56916
Slc22a12
Name: solute carrier family 22 (organic anion/cation transporter), member 12
Synonyms: Rst, URAT1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20521
Homologene: 56442
Gimap4
Name: GTPase, IMAP family member 4
Synonyms: E430007K16Rik, Ian1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 107526
Homologene: 75084
Csn1s2b
Name: casein alpha s2-like B
Synonyms: Csnd, Csne
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12992
Homologene: 49221
Slc14a1
Name: solute carrier family 14 (urea transporter), member 1
Synonyms: UT-B, 3021401A05Rik, 2610507K20Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 108052
Homologene: 9285
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to T, chromosome 1 at 151,384,497 bp
  • C to T, chromosome 2 at 20,880,405 bp
  • C to T, chromosome 2 at 27,230,455 bp
  • A to G, chromosome 2 at 132,244,065 bp
  • T to C, chromosome 3 at 87,735,552 bp
  • T to C, chromosome 5 at 3,643,540 bp
  • G to T, chromosome 5 at 31,487,922 bp
  • T to C, chromosome 5 at 32,795,614 bp
  • G to T, chromosome 5 at 87,819,092 bp
  • G to T, chromosome 5 at 92,634,251 bp
  • CACCTTCTCCCCAGAACCCCACACCTTACCTG to C, chromosome 5 at 137,302,498 bp
  • C to T, chromosome 6 at 41,699,024 bp
  • A to T, chromosome 6 at 48,690,750 bp
  • T to C, chromosome 6 at 146,773,383 bp
  • T to A, chromosome 7 at 45,409,523 bp
  • CG to CGACCGCGGGG, chromosome 7 at 97,579,908 bp
  • T to C, chromosome 7 at 143,715,735 bp
  • C to T, chromosome 9 at 110,068,744 bp
  • A to T, chromosome 10 at 27,328,149 bp
  • T to C, chromosome 11 at 67,303,676 bp
  • T to C, chromosome 11 at 97,337,801 bp
  • T to C, chromosome 12 at 73,942,027 bp
  • C to T, chromosome 13 at 21,368,852 bp
  • T to C, chromosome 16 at 20,280,051 bp
  • T to A, chromosome 16 at 20,708,762 bp
  • C to T, chromosome 16 at 37,061,316 bp
  • A to G, chromosome 16 at 38,534,733 bp
  • A to T, chromosome 17 at 19,053,650 bp
  • G to A, chromosome 17 at 24,407,697 bp
  • G to A, chromosome 18 at 37,487,449 bp
  • T to C, chromosome 18 at 78,116,512 bp
  • T to A, chromosome 19 at 6,538,439 bp
  • GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG to GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG, chromosome Y at 2,662,638 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8028 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067467-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.