Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8068Btlr/Mmmh
Stock Number:
067503-MU
Citation ID:
RRID:MMRRC_067503-MU
Other Names:
R8068 (G1)
Major Collection:

Strain Information

Qki
Name: quaking, KH domain containing RNA binding
Synonyms: l(17)-1Wis, QkI, l17Wis1, 1110003F05Rik, Qk
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 19317
VEGA: 17
Homologene: 11059
Nrp2
Name: neuropilin 2
Synonyms: NP2, Npn-2, Npn2, NP-2, 1110048P06Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18187
HGNC: HGNC:8005
Homologene: 2875
Elf1
Name: E74 like ETS transcription factor 1
Synonyms: Elf-1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 13709
VEGA: 14
HGNC: HGNC:3316
Homologene: 7303
Slc1a6
Name: solute carrier family 1 (high affinity aspartate/glutamate transporter), member 6
Synonyms: EAAT4
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 20513
VEGA: 10
Homologene: 21055
Rnf111
Name: ring finger protein 111
Synonyms: Arkadia
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 93836
VEGA: 9
Homologene: 9741
Ltbp4
Name: latent transforming growth factor beta binding protein 4
Synonyms: 2310046A13Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 108075
HGNC: HGNC:6717
Homologene: 2645
Carmil1
Name: capping protein regulator and myosin 1 linker 1
Synonyms: 1110037D04Rik, Lrrc16, Carmil, Lrrc16a
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 68732
Homologene: 9757
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 62,745,408 bp
  • T to C, chromosome 1 at 75,422,250 bp
  • A to T, chromosome 1 at 91,128,102 bp
  • T to C, chromosome 1 at 135,063,664 bp
  • T to C, chromosome 1 at 158,935,985 bp
  • TTGCTGCTGCTGCTGCTGCTGCTGCTGC to TTGCTGCTGCTGCTGCTGCTGCTGC, chromosome 1 at 162,709,061 bp
  • A to G, chromosome 1 at 192,241,942 bp
  • A to G, chromosome 2 at 85,849,806 bp
  • A to G, chromosome 2 at 87,868,651 bp
  • A to G, chromosome 2 at 164,408,518 bp
  • A to T, chromosome 3 at 64,716,086 bp
  • T to C, chromosome 3 at 83,300,438 bp
  • T to G, chromosome 3 at 107,194,410 bp
  • T to A, chromosome 3 at 123,117,392 bp
  • C to A, chromosome 4 at 20,028,419 bp
  • T to C, chromosome 4 at 102,596,015 bp
  • A to G, chromosome 4 at 119,236,862 bp
  • T to C, chromosome 5 at 3,643,540 bp
  • C to A, chromosome 5 at 115,952,466 bp
  • T to C, chromosome 5 at 115,982,235 bp
  • A to G, chromosome 5 at 123,256,166 bp
  • A to T, chromosome 6 at 89,933,279 bp
  • A to G, chromosome 6 at 118,413,750 bp
  • A to G, chromosome 7 at 19,244,985 bp
  • G to T, chromosome 7 at 27,324,168 bp
  • T to A, chromosome 7 at 104,618,253 bp
  • T to A, chromosome 7 at 141,744,685 bp
  • T to A, chromosome 8 at 40,825,938 bp
  • G to T, chromosome 8 at 104,932,997 bp
  • A to G, chromosome 8 at 116,956,650 bp
  • T to C, chromosome 9 at 27,063,361 bp
  • A to T, chromosome 9 at 70,457,941 bp
  • A to C, chromosome 9 at 72,448,527 bp
  • G to A, chromosome 9 at 89,211,235 bp
  • G to C, chromosome 10 at 78,812,872 bp
  • A to G, chromosome 10 at 118,146,804 bp
  • C to G, chromosome 10 at 128,195,114 bp
  • A to C, chromosome 11 at 53,997,443 bp
  • T to C, chromosome 11 at 78,324,727 bp
  • T to C, chromosome 11 at 95,145,330 bp
  • T to A, chromosome 11 at 104,665,511 bp
  • T to A, chromosome 13 at 24,075,728 bp
  • A to T, chromosome 14 at 54,908,908 bp
  • T to A, chromosome 14 at 67,724,662 bp
  • T to A, chromosome 14 at 79,536,390 bp
  • T to A, chromosome 15 at 12,883,190 bp
  • T to C, chromosome 15 at 71,532,978 bp
  • T to A, chromosome 16 at 49,895,416 bp
  • T to C, chromosome 16 at 69,860,524 bp
  • T to A, chromosome 16 at 76,292,953 bp
  • T to C, chromosome 17 at 10,318,803 bp
  • A to T, chromosome 17 at 21,509,012 bp
  • T to C, chromosome 17 at 80,050,852 bp
  • T to A, chromosome 18 at 37,005,565 bp
  • A to G, chromosome 19 at 5,760,825 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8068 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067503-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.