Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8077Btlr/Mmmh
Stock Number:
067511-MU
Citation ID:
RRID:MMRRC_067511-MU
Other Names:
R8077 (G1)
Major Collection:

Strain Information

Itga8
Name: integrin alpha 8
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241226
HGNC: HGNC:6144
Homologene: 37396
Ptch1
Name: patched 1
Synonyms: Ptc, Patched 1, Ptc1, A230106A15Rik, wig
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 19206
HGNC: HGNC:9585
Homologene: 223
Lrrn1
Name: leucine rich repeat protein 1, neuronal
Synonyms: NLRR-1, 2810047E21Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16979
Homologene: 32036
Tns3
Name: tensin 3
Synonyms: TEM6, F830010I22Rik, Tens1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 319939
Homologene: 49713
Col18a1
Name: collagen, type XVIII, alpha 1
Synonyms: endostatin
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 12822
HGNC: HGNC:2195
Homologene: 7673
Ssbp4
Name: single stranded DNA binding protein 4
Synonyms: 1210002E11Rik, Ssdp4
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 76900
Homologene: 41881
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 71,612,602 bp
  • A to T, chromosome 1 at 88,138,853 bp
  • A to T, chromosome 1 at 136,471,448 bp
  • A to G, chromosome 1 at 170,248,173 bp
  • A to G, chromosome 1 at 174,151,845 bp
  • A to G, chromosome 1 at 188,542,828 bp
  • C to T, chromosome 2 at 12,242,433 bp
  • A to G, chromosome 2 at 31,642,304 bp
  • A to G, chromosome 2 at 80,638,936 bp
  • C to A, chromosome 2 at 132,089,172 bp
  • A to G, chromosome 3 at 68,916,145 bp
  • G to A, chromosome 3 at 142,507,739 bp
  • A to G, chromosome 3 at 145,071,527 bp
  • T to C, chromosome 3 at 146,190,414 bp
  • A to G, chromosome 4 at 86,855,921 bp
  • G to A, chromosome 4 at 107,209,491 bp
  • T to G, chromosome 4 at 136,543,091 bp
  • T to C, chromosome 4 at 144,528,556 bp
  • G to C, chromosome 5 at 90,467,355 bp
  • C to A, chromosome 5 at 105,480,017 bp
  • A to T, chromosome 6 at 85,473,229 bp
  • T to C, chromosome 6 at 107,568,822 bp
  • A to G, chromosome 6 at 129,766,695 bp
  • A to T, chromosome 7 at 48,198,455 bp
  • C to A, chromosome 7 at 84,003,408 bp
  • A to T, chromosome 7 at 85,006,885 bp
  • C to T, chromosome 7 at 140,691,133 bp
  • C to T, chromosome 7 at 142,273,816 bp
  • A to T, chromosome 7 at 142,370,967 bp
  • G to T, chromosome 8 at 12,998,494 bp
  • A to T, chromosome 8 at 14,894,950 bp
  • G to T, chromosome 8 at 46,170,445 bp
  • A to G, chromosome 8 at 64,965,544 bp
  • T to C, chromosome 8 at 70,598,997 bp
  • G to A, chromosome 8 at 105,359,380 bp
  • C to T, chromosome 8 at 110,110,103 bp
  • A to T, chromosome 9 at 14,550,502 bp
  • C to T, chromosome 9 at 21,420,096 bp
  • C to T, chromosome 9 at 55,987,966 bp
  • A to T, chromosome 9 at 96,688,100 bp
  • A to G, chromosome 9 at 108,828,331 bp
  • T to C, chromosome 10 at 62,665,566 bp
  • C to A, chromosome 10 at 77,080,851 bp
  • T to A, chromosome 10 at 77,811,770 bp
  • G to A, chromosome 10 at 80,531,024 bp
  • A to T, chromosome 11 at 8,445,667 bp
  • A to T, chromosome 11 at 23,517,237 bp
  • A to G, chromosome 11 at 49,160,485 bp
  • T to A, chromosome 12 at 72,940,326 bp
  • T to A, chromosome 12 at 116,342,228 bp
  • A to T, chromosome 13 at 63,540,812 bp
  • T to C, chromosome 14 at 27,385,924 bp
  • T to C, chromosome 14 at 51,049,941 bp
  • C to T, chromosome 14 at 99,090,035 bp
  • T to A, chromosome 15 at 8,311,250 bp
  • T to C, chromosome 15 at 37,946,800 bp
  • T to C, chromosome 16 at 32,810,434 bp
  • A to G, chromosome 16 at 36,918,633 bp
  • T to C, chromosome 16 at 43,915,605 bp
  • T to C, chromosome 17 at 26,255,073 bp
  • TCAGTGGTGGTCAGGATGGGGGTAGAGCCTGAGCCACTCCTGGATGCAGTGGTGGTCAGG to TCAGTGGTGGTCAGG, chromosome 17 at 35,619,736 bp
  • T to G, chromosome 19 at 55,576,485 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8077 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.

Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain's tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067511-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.