Strain Name:
C57BL/6J-MtgxR8094Btlr/Mmmh
Stock Number:
067526-MU
Citation ID:
RRID:MMRRC_067526-MU
Other Names:
R8094 (G1)
Major Collection:

Strain Information

Chrnb2
Name: cholinergic receptor nicotinic beta 2 subunit
Synonyms: [b]2-nAchR, Acrb-2, Acrb2, C030030P04Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 11444
HGNC: HGNC:1962
Homologene: 595
Dst
Name: dystonin
Synonyms: bullous pemphigoid antigen 1, BPAG1-n, BPAG1, Bpag1, Bpag, ah, Macf2, bullous pemphigoid antigen 1, athetoid, 2310001O04Rik, nmf203, A830042E19Rik, nmf339
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13518
HGNC: HGNC:1090
Homologene: 136716
Macf1
Name: microtubule-actin crosslinking factor 1
Synonyms: Acf7, Aclp7, trabeculin alpha
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11426
Homologene: 136191
Rictor
Name: RPTOR independent companion of MTOR, complex 2
Synonyms: 6030405M08Rik, D530039E11Rik, 4921505C17Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 78757
VEGA: 15
Homologene: 34317
Mrpl14
Name: mitochondrial ribosomal protein L14
Synonyms: MRP-L32, Rpml32, 1110006I11Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 68463
Homologene: 12268
Slc25a33
Name: solute carrier family 25, member 33
Synonyms: Pnc1, 5730438N18Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 70556
Homologene: 57076
Cep290
Name: centrosomal protein 290
Synonyms: Nphp6, b2b1454Clo, b2b1752Clo, Kiaa
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216274
VEGA: 10
Homologene: 77213
Atf1
Name: activating transcription factor 1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 11908
HGNC: HGNC:783
Homologene: 3790
Arid2
Name: AT-rich interaction domain 2
Synonyms: 4432409D24Rik, zipzap/p200, 1700124K17Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 77044
Homologene: 14601
Fbxo15
Name: F-box protein 15
Synonyms: Fbx15, ecat3
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 50764
VEGA: 18
Homologene: 17644
Uvrag
Name: UV radiation resistance associated gene
Synonyms: 9530039D02Rik, Uvragl
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 78610
Homologene: 31150
Cbl
Name: Casitas B-lineage lymphoma
Synonyms: Cbl-2, c-Cbl, 4732447J05Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12402
HGNC: HGNC:1541
Homologene: 3802
Herc1
Name: HECT and RLD domain containing E3 ubiquitin protein ligase family member 1
Synonyms: D130015N03Rik, 2810449H11Rik, tbl
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235439
HGNC: HGNC:4867
Homologene: 31207
Tmem161b
Name: transmembrane protein 161B
Synonyms: 2810446P07Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 72745
Homologene: 14519
Ralgapa1
Name: Ral GTPase activating protein, alpha subunit 1
Synonyms: 4930400K19Rik, Tulip1, 2310003F20Rik, Garnl1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 56784
VEGA: 12
Homologene: 84805
Syne1
Name: spectrin repeat containing, nuclear envelope 1
Synonyms: SYNE-1, A330049M09Rik, enaptin165, nesprin-1, C130039F11Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 64009
VEGA: 10
Homologene: 52329
Cyp51
Name: cytochrome P450, family 51
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 13121
HGNC: HGNC:2649
Homologene: 55488
Sgo2a
Name: shugoshin 2A
Synonyms: D1Ertd8e, Sgol2a, Sgol2, Tripin, 5730576N04Rik, 1110007N04Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 68549
Homologene: 51867
Drg2
Name: developmentally regulated GTP binding protein 2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 13495
HGNC: HGNC:3030
Homologene: 1061
Satb2
Name: special AT-rich sequence binding protein 2
Synonyms: BAP002
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 212712
Homologene: 32249
Gucy2c
Name: guanylate cyclase 2c
Synonyms: GC-C
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14917
HGNC: HGNC:4688
Homologene: 3641
Vps13b
Name: vacuolar protein sorting 13B
Synonyms: C330002D13Rik, Coh1, 1810042B05Rik, 2310042E16Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 666173
VEGA: 15
HGNC: HGNC:2183
Homologene: 49516
Ubr4
Name: ubiquitin protein ligase E3 component n-recognin 4
Synonyms: A930005E13Rik, 1810009A16Rik, Zubr1, D930005K06Rik, p600, LOC381562
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 69116
Homologene: 10804
Npc1
Name: NPC intracellular cholesterol transporter 1
Synonyms: D18Ertd723e, D18Ertd139e, C85354, lcsd, A430089E03Rik, nmf164
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 18145
HGNC: HGNC:7897
Homologene: 228
Pigr
Name: polymeric immunoglobulin receptor
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18703
HGNC: HGNC:8968
Homologene: 1984
Dkk2
Name: dickkopf WNT signaling pathway inhibitor 2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 56811
HGNC: HGNC:2892
Homologene: 8681
Kirrel3
Name: kirre like nephrin family adhesion molecule 3
Synonyms: Neph2, 1500010O20Rik, 2900036G11Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 67703
Homologene: 57050
Ptprs
Name: protein tyrosine phosphatase receptor type S
Synonyms: PTP-NU3, PTPsigma, RPTPsigma, Ptpt9
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 19280
HGNC: HGNC:9681
Homologene: 20626
Fat1
Name: FAT atypical cadherin 1
Synonyms: mFat1, 2310038E12Rik, Fath
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 14107
HGNC: HGNC:3595
Homologene: 66302
Brca2
Name: breast cancer 2, early onset
Synonyms: RAB163, Fancd1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12190
HGNC: HGNC:1101
Homologene: 41
Dsg2
Name: desmoglein 2
Synonyms: D18Ertd293e
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 13511
HGNC: HGNC:3049
Homologene: 1464
Mkln1
Name: muskelin 1, intracellular mediator containing kelch motifs
Synonyms: A130067F06Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 27418
HGNC: HGNC:7109
Homologene: 8305
Sympk
Name: symplekin
Synonyms: 1500016F02Rik, 4632415H16Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 68188
Homologene: 37969
Akap11
Name: A kinase anchor protein 11
Synonyms: 6330501D17Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219181
HGNC: HGNC:369
Homologene: 8279
Serpina10
Name: serine (or cysteine) peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 10
Synonyms: PZI
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217847
Homologene: 9414
Akap2
Name: A kinase (PRKA) anchor protein 2
Synonyms: B230340M18Rik, AKAP-KL
Type: Gene
Species: Mouse
Chromosome: 4
Nos3
Name: nitric oxide synthase 3, endothelial cell
Synonyms: eNOS, ecNOS, Nos-3, 2310065A03Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18127
HGNC: HGNC:7876
Homologene: 504
Nell1
Name: NEL-like 1
Synonyms: B230343H07Rik, l7R6
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 338352
HGNC: HGNC:7750
Homologene: 4486
Camta2
Name: calmodulin binding transcription activator 2
Synonyms: Kiaa0909-hp
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216874
Homologene: 9021
Fat2
Name: FAT atypical cadherin 2
Synonyms: LOC245827, mKIAA0811, Fath2, EMI2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 245827
HGNC: HGNC:3596
Homologene: 1110
Rnpep
Name: arginyl aminopeptidase (aminopeptidase B)
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 215615
Homologene: 10628
Uckl1
Name: uridine-cytidine kinase 1-like 1
Synonyms: Urkl1, 1110007H10Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 68556
Homologene: 101414
F5
Name: coagulation factor V
Synonyms: Cf-5, Cf5
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14067
HGNC: HGNC:3542
Homologene: 104
Fcsk
Name: fucose kinase
Synonyms: L-fucose kinase, 1110046B12Rik, Fuk
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234730
Homologene: 15452
Naip2
Name: NLR family, apoptosis inhibitory protein 2
Synonyms: Naip-rs6, Naip2, Birc1b
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17948
HGNC: HGNC:7634
Homologene: 136092
Rb1cc1
Name: RB1-inducible coiled-coil 1
Synonyms: LaXp180, 2900055E04Rik, Cc1, 5930404L04Rik, Fip200
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12421
Homologene: 7659
Or6c210
Name: olfactory receptor family 6 subfamily C member 210
Synonyms: GA_x6K02T2PULF-11338429-11339364, MOR114-7, Olfr800
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 258541
Homologene: 27203
Nxpe5
Name: neurexophilin and PC-esterase domain family, member 5
Synonyms: Fam55 related, BC055004
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 381680
Homologene: 134143
Gabrb2
Name: gamma-aminobutyric acid type A receptor subunit beta 2
Synonyms: Gabrb-2, C030021G16Rik, C030002O17Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14401
HGNC: HGNC:4082
Homologene: 7327
Phldb3
Name: pleckstrin homology like domain, family B, member 3
Synonyms: EG232970, Gm10102
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 232970
Homologene: 109375
A2ml1
Name: alpha-2-macroglobulin like 1
Synonyms: Ovos2, BC048546
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232400
Homologene: 45969
Rtn2
Name: reticulon 2 (Z-band associated protein)
Synonyms: Nspl1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20167
Homologene: 32180
Myom2
Name: myomesin 2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 17930
HGNC: HGNC:7614
Homologene: 2953
Tmem94
Name: transmembrane protein 94
Synonyms: 2310067B10Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 71947
Homologene: 8831
Ogfr
Name: opioid growth factor receptor
Synonyms: 2010013E17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 72075
Homologene: 7199
Thbs2
Name: thrombospondin 2
Synonyms: Thrombospondin-2, Thbs-2, TSP2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 21826
VEGA: 17
Homologene: 2438
Ndst2
Name: N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 2
Synonyms: glucosaminyl N-deacetylase/N-sulphotransferase-2, Mndns, [Heparan sulfate]-glucosamine N-sulfotransferase
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 17423
VEGA: 14
HGNC: HGNC:7681
Homologene: 20803
Vmn2r104
Name: vomeronasal 2, receptor 104
Synonyms: V2r7
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 22313
Homologene: 129751
Or5b98
Name: olfactory receptor family 5 subfamily B member 98
Synonyms: GA_x6K02T2RE5P-3283121-3284098, MOR202-33, Olfr1450
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258368
Zfp217
Name: zinc finger protein 217
Synonyms: 4933431C08Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228913
Homologene: 4757
Sp100
Name: nuclear antigen Sp100
Synonyms: A430075G10Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 20684
Homologene: 86761
Dnah7b
Name: dynein, axonemal, heavy chain 7B
Synonyms: LOC227058, Dnahc7b
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227058
Homologene: 41287
Cacna1e
Name: calcium channel, voltage-dependent, R type, alpha 1E subunit
Synonyms: Cav2.3, Cchra1, alpha1E
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12290
HGNC: HGNC:1392
Homologene: 20185
A230072I06Rik
Name: RIKEN cDNA A230072I06 gene
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 619290
VEGA: 8
Osmr
Name: oncostatin M receptor
Synonyms: OSMRB
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 18414
HGNC: HGNC:8507
Homologene: 2972
Cyp2d22
Name: cytochrome P450, family 2, subfamily d, polypeptide 22
Synonyms: 2D22
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 56448
VEGA: 15
Homologene: 75003
Vmn2r11
Name: vomeronasal 2, receptor 11
Synonyms: EG384219
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 384219
Homologene: 129606
Gtpbp3
Name: GTP binding protein 3
Synonyms: Gtpbp3, 2410009F13Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 70359
Homologene: 6600
Cyp2c40
Name: cytochrome P450, family 2, subfamily c, polypeptide 40
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 13099
Homologene: 74936
Ptpru
Name: protein tyrosine phosphatase receptor type U
Synonyms: Ptprl, RPTPlambda
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 19273
HGNC: HGNC:9683
Homologene: 4168
Galk2
Name: galactokinase 2
Synonyms: Gk2, 2810017M24Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 69976
HGNC: HGNC:4119
Homologene: 13654
Spaca1
Name: sperm acrosome associated 1
Synonyms: 1700124L11Rik, 4930540L03Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 67652
Homologene: 12170
Ccdc162
Name: coiled-coil domain containing 162
Synonyms: 5033413D22Rik, Gm29096, Gm6976
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 75973
Homologene: 136355
Tha1
Name: threonine aldolase 1
Synonyms: GLY1, 1300017K07Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 71776
Homologene: 57081
Or1j1
Name: olfactory receptor family 1 subfamily J member 1
Synonyms: Y71, MOR136-14, GA_x6K02T2NLDC-33507606-33506665, Olfr3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18328
HGNC: HGNC:8208
Homologene: 66579
Oxct2b
Name: 3-oxoacid CoA transferase 2B
Synonyms: Scot-t2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 353371
Homologene: 137359
Cd177
Name: CD177 antigen
Synonyms: Pdp3, 1190003K14Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 68891
Homologene: 49628
Mill1
Name: MHC I like leukocyte 1
Synonyms: 5530400I18Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 266815
HGNC: HGNC:7090
Homologene: 105329
Fhit
Name: fragile histidine triad gene
Synonyms: Fra14A2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 14198
HGNC: HGNC:3701
Homologene: 21661
Trcg1
Name: taste receptor cell gene 1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 541610
Homologene: 134171
Tas2r121
Name: taste receptor, type 2, member 121
Synonyms: mGR21, mT2r48, Tas2r21, T2R21
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 387349
Homologene: 41542
Disp1
Name: dispatched RND transporter family member 1
Synonyms: DispA, 1190008H24Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 68897
Homologene: 14133
Tnfsf13
Name: tumor necrosis factor (ligand) superfamily, member 13
Synonyms: 2310026N09Rik, TALL2, TRDL1, APRIL
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 69583
Homologene: 56971
Wipf1
Name: WAS/WASL interacting protein family, member 1
Synonyms: Waspip, WIP, D2Ertd120e
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 215280
Homologene: 86891
Btg4
Name: BTG anti-proliferation factor 4
Synonyms: PC3B
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 56057
VEGA: 9
Homologene: 9734
Or4c110
Name: olfactory receptor family 4 subfamily C member 110
Synonyms: GA_x6K02T2Q125-50482823-50481885, MOR233-13, Olfr1215
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258451
Homologene: 74071
Sds
Name: serine dehydratase
Synonyms: SDH
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231691
Homologene: 38235
Btbd18
Name: BTB domain containing 18
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 100270744
Homologene: 122125
Dpt
Name: dermatopontin
Synonyms: early quiescence protein-1, EQ-1, 5033416F05Rik, 1810032B19Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 56429
HGNC: HGNC:3011
Homologene: 1458
Slc25a51
Name: solute carrier family 25, member 51
Synonyms: D130005A03Rik, Mcart1, 9130208E07Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230125
Homologene: 88487
Zscan4f
Name: zinc finger and SCAN domain containing 4F
Synonyms: C330039H09Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 665902
Homologene: 85986
Slfn14
Name: schlafen 14
Synonyms: Slfn14-ps, LOC237890
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237890
Homologene: 19082
Dchs2
Name: dachsous cadherin related 2
Synonyms: LOC229459
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 100534287
Iqcn
Name: IQ motif containing N
Synonyms: Gm16486
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 637079
Homologene: 141171
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 6,263,224 bp
  • T to G, chromosome 1 at 34,188,959 bp
  • T to C, chromosome 1 at 46,126,804 bp
  • A to T, chromosome 1 at 56,831,464 bp
  • T to C, chromosome 1 at 58,017,141 bp
  • A to G, chromosome 1 at 85,697,098 bp
  • A to G, chromosome 1 at 130,846,510 bp
  • A to T, chromosome 1 at 135,283,776 bp
  • G to A, chromosome 1 at 154,561,770 bp
  • A to G, chromosome 1 at 164,208,940 bp
  • A to T, chromosome 1 at 164,796,912 bp
  • C to A, chromosome 1 at 183,087,628 bp
  • A to T, chromosome 2 at 36,812,318 bp
  • G to A, chromosome 2 at 73,437,535 bp
  • T to A, chromosome 2 at 84,667,916 bp
  • T to C, chromosome 2 at 89,002,368 bp
  • T to C, chromosome 2 at 125,931,269 bp
  • G to A, chromosome 2 at 170,119,651 bp
  • GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG to GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG, chromosome 2 at 180,595,266 bp
  • A to G, chromosome 2 at 181,573,256 bp
  • T to C, chromosome 3 at 83,355,622 bp
  • T to A, chromosome 3 at 89,761,391 bp
  • C to T, chromosome 3 at 132,086,040 bp
  • C to T, chromosome 4 at 34,049,837 bp
  • A to C, chromosome 4 at 45,399,783 bp
  • A to G, chromosome 4 at 57,886,319 bp
  • A to G, chromosome 4 at 123,116,508 bp
  • C to A, chromosome 4 at 123,369,867 bp
  • G to A, chromosome 4 at 131,793,592 bp
  • T to C, chromosome 4 at 139,440,696 bp
  • T to A, chromosome 4 at 149,756,152 bp
  • C to T, chromosome 5 at 4,086,490 bp
  • G to C, chromosome 5 at 24,367,220 bp
  • A to T, chromosome 5 at 109,053,760 bp
  • T to C, chromosome 5 at 120,478,936 bp
  • T to A, chromosome 5 at 138,251,540 bp
  • T to A, chromosome 5 at 150,536,169 bp
  • T to A, chromosome 6 at 31,492,653 bp
  • A to G, chromosome 6 at 128,572,082 bp
  • T to A, chromosome 6 at 132,700,809 bp
  • T to A, chromosome 6 at 136,737,448 bp
  • T to A, chromosome 7 at 11,401,227 bp
  • C to T, chromosome 7 at 18,255,910 bp
  • T to G, chromosome 7 at 19,053,448 bp
  • A to T, chromosome 7 at 19,293,866 bp
  • C to A, chromosome 7 at 24,626,709 bp
  • A to T, chromosome 7 at 24,744,417 bp
  • T to A, chromosome 7 at 50,120,587 bp
  • T to C, chromosome 7 at 98,991,967 bp
  • T to A, chromosome 8 at 12,279,824 bp
  • G to T, chromosome 8 at 15,069,418 bp
  • T to C, chromosome 8 at 44,952,702 bp
  • T to C, chromosome 8 at 70,709,418 bp
  • C to T, chromosome 8 at 71,488,836 bp
  • A to G, chromosome 8 at 110,895,972 bp
  • G to A, chromosome 9 at 35,035,164 bp
  • A to T, chromosome 9 at 44,163,399 bp
  • T to G, chromosome 9 at 51,119,145 bp
  • C to A, chromosome 9 at 57,242,281 bp
  • G to A, chromosome 9 at 66,493,180 bp
  • A to T, chromosome 10 at 5,117,031 bp
  • A to T, chromosome 10 at 41,612,868 bp
  • A to T, chromosome 10 at 100,544,931 bp
  • A to G, chromosome 10 at 129,660,064 bp
  • A to G, chromosome 11 at 42,597,543 bp
  • C to T, chromosome 11 at 55,296,139 bp
  • A to T, chromosome 11 at 60,462,270 bp
  • A to G, chromosome 11 at 69,685,157 bp
  • A to G, chromosome 11 at 70,686,077 bp
  • T to A, chromosome 11 at 83,283,293 bp
  • T to C, chromosome 11 at 115,788,392 bp
  • T to C, chromosome 11 at 117,868,497 bp
  • T to A, chromosome 12 at 55,782,846 bp
  • TTCCTCCTCCTCCTCCTCCTCCTCC to TTCCTCCTCCTCCTCCTCCTCC, chromosome 12 at 103,628,773 bp
  • C to A, chromosome 13 at 84,222,418 bp
  • A to C, chromosome 13 at 100,161,782 bp
  • A to T, chromosome 14 at 10,751,666 bp
  • A to T, chromosome 14 at 20,728,164 bp
  • C to A, chromosome 14 at 78,512,973 bp
  • C to T, chromosome 15 at 6,772,154 bp
  • T to C, chromosome 15 at 6,815,621 bp
  • T to A, chromosome 15 at 35,668,906 bp
  • C to A, chromosome 15 at 82,374,355 bp
  • T to G, chromosome 15 at 96,368,711 bp
  • C to A, chromosome 15 at 100,245,289 bp
  • T to A, chromosome 17 at 14,680,322 bp
  • C to A, chromosome 17 at 20,030,221 bp
  • T to A, chromosome 17 at 45,698,113 bp
  • T to C, chromosome 17 at 56,428,947 bp
  • A to T, chromosome 18 at 12,194,240 bp
  • A to G, chromosome 18 at 20,583,004 bp
  • A to G, chromosome 18 at 84,965,493 bp
  • A to T, chromosome 19 at 12,954,002 bp
  • A to G, chromosome 19 at 39,802,565 bp
  • T to A, chromosome 19 at 39,802,571 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8094 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067526-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.