Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8094Btlr/Mmmh
Stock Number:
067526-MU
Citation ID:
RRID:MMRRC_067526-MU
Other Names:
R8094 (G1)
Major Collection:

Strain Information

Chrnb2
Name: cholinergic receptor nicotinic beta 2 subunit
Synonyms: [b]2-nAchR, Acrb-2, Acrb2, C030030P04Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 11444
HGNC: HGNC:1962
Homologene: 595
Dst
Name: dystonin
Synonyms: bullous pemphigoid antigen 1, BPAG1-n, BPAG1, Bpag1, Bpag, ah, bullous pemphigoid antigen 1, athetoid, Macf2, 2310001O04Rik, nmf203, A830042E19Rik, nmf339
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13518
HGNC: HGNC:1090
Homologene: 136716
Macf1
Name: microtubule-actin crosslinking factor 1
Synonyms: Acf7, Aclp7, trabeculin alpha
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11426
Homologene: 136191
Rictor
Name: RPTOR independent companion of MTOR, complex 2
Synonyms: 6030405M08Rik, D530039E11Rik, 4921505C17Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 78757
VEGA: 15
Homologene: 34317
Mrpl14
Name: mitochondrial ribosomal protein L14
Synonyms: MRP-L32, Rpml32, 1110006I11Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 68463
Homologene: 12268
Slc25a33
Name: solute carrier family 25, member 33
Synonyms: 5730438N18Rik, Pnc1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 70556
Homologene: 57076
Cep290
Name: centrosomal protein 290
Synonyms: Nphp6, b2b1454Clo, b2b1752Clo, Kiaa
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216274
VEGA: 10
Homologene: 77213
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 6,263,224 bp
  • T to G, chromosome 1 at 34,188,959 bp
  • T to C, chromosome 1 at 46,126,804 bp
  • A to T, chromosome 1 at 56,831,464 bp
  • T to C, chromosome 1 at 58,017,141 bp
  • A to G, chromosome 1 at 85,697,098 bp
  • A to G, chromosome 1 at 130,846,510 bp
  • A to T, chromosome 1 at 135,283,776 bp
  • G to A, chromosome 1 at 154,561,770 bp
  • A to G, chromosome 1 at 164,208,940 bp
  • A to T, chromosome 1 at 164,796,912 bp
  • C to A, chromosome 1 at 183,087,628 bp
  • A to T, chromosome 2 at 36,812,318 bp
  • G to A, chromosome 2 at 73,437,535 bp
  • T to A, chromosome 2 at 84,667,916 bp
  • T to C, chromosome 2 at 89,002,368 bp
  • T to C, chromosome 2 at 125,931,269 bp
  • G to A, chromosome 2 at 170,119,651 bp
  • GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG to GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG, chromosome 2 at 180,595,266 bp
  • A to G, chromosome 2 at 181,573,256 bp
  • T to C, chromosome 3 at 83,355,622 bp
  • T to A, chromosome 3 at 89,761,391 bp
  • C to T, chromosome 3 at 132,086,040 bp
  • C to T, chromosome 4 at 34,049,837 bp
  • A to C, chromosome 4 at 45,399,783 bp
  • A to G, chromosome 4 at 57,886,319 bp
  • A to G, chromosome 4 at 123,116,508 bp
  • C to A, chromosome 4 at 123,369,867 bp
  • G to A, chromosome 4 at 131,793,592 bp
  • T to C, chromosome 4 at 139,440,696 bp
  • T to A, chromosome 4 at 149,756,152 bp
  • C to T, chromosome 5 at 4,086,490 bp
  • G to C, chromosome 5 at 24,367,220 bp
  • A to T, chromosome 5 at 109,053,760 bp
  • T to C, chromosome 5 at 120,478,936 bp
  • T to A, chromosome 5 at 138,251,540 bp
  • T to A, chromosome 5 at 150,536,169 bp
  • T to A, chromosome 6 at 31,492,653 bp
  • A to G, chromosome 6 at 128,572,082 bp
  • T to A, chromosome 6 at 132,700,809 bp
  • T to A, chromosome 6 at 136,737,448 bp
  • T to A, chromosome 7 at 11,401,227 bp
  • C to T, chromosome 7 at 18,255,910 bp
  • T to G, chromosome 7 at 19,053,448 bp
  • A to T, chromosome 7 at 19,293,866 bp
  • C to A, chromosome 7 at 24,626,709 bp
  • A to T, chromosome 7 at 24,744,417 bp
  • T to A, chromosome 7 at 50,120,587 bp
  • T to C, chromosome 7 at 98,991,967 bp
  • T to A, chromosome 8 at 12,279,824 bp
  • G to T, chromosome 8 at 15,069,418 bp
  • T to C, chromosome 8 at 44,952,702 bp
  • T to C, chromosome 8 at 70,709,418 bp
  • C to T, chromosome 8 at 71,488,836 bp
  • A to G, chromosome 8 at 110,895,972 bp
  • G to A, chromosome 9 at 35,035,164 bp
  • A to T, chromosome 9 at 44,163,399 bp
  • T to G, chromosome 9 at 51,119,145 bp
  • C to A, chromosome 9 at 57,242,281 bp
  • G to A, chromosome 9 at 66,493,180 bp
  • A to T, chromosome 10 at 5,117,031 bp
  • A to T, chromosome 10 at 41,612,868 bp
  • A to T, chromosome 10 at 100,544,931 bp
  • A to G, chromosome 10 at 129,660,064 bp
  • A to G, chromosome 11 at 42,597,543 bp
  • C to T, chromosome 11 at 55,296,139 bp
  • A to T, chromosome 11 at 60,462,270 bp
  • A to G, chromosome 11 at 69,685,157 bp
  • A to G, chromosome 11 at 70,686,077 bp
  • T to A, chromosome 11 at 83,283,293 bp
  • T to C, chromosome 11 at 115,788,392 bp
  • T to C, chromosome 11 at 117,868,497 bp
  • T to A, chromosome 12 at 55,782,846 bp
  • TTCCTCCTCCTCCTCCTCCTCCTCC to TTCCTCCTCCTCCTCCTCCTCC, chromosome 12 at 103,628,773 bp
  • C to A, chromosome 13 at 84,222,418 bp
  • A to C, chromosome 13 at 100,161,782 bp
  • A to T, chromosome 14 at 10,751,666 bp
  • A to T, chromosome 14 at 20,728,164 bp
  • C to A, chromosome 14 at 78,512,973 bp
  • C to T, chromosome 15 at 6,772,154 bp
  • T to C, chromosome 15 at 6,815,621 bp
  • T to A, chromosome 15 at 35,668,906 bp
  • C to A, chromosome 15 at 82,374,355 bp
  • T to G, chromosome 15 at 96,368,711 bp
  • C to A, chromosome 15 at 100,245,289 bp
  • T to A, chromosome 17 at 14,680,322 bp
  • C to A, chromosome 17 at 20,030,221 bp
  • T to A, chromosome 17 at 45,698,113 bp
  • T to C, chromosome 17 at 56,428,947 bp
  • A to T, chromosome 18 at 12,194,240 bp
  • A to G, chromosome 18 at 20,583,004 bp
  • A to G, chromosome 18 at 84,965,493 bp
  • A to T, chromosome 19 at 12,954,002 bp
  • A to G, chromosome 19 at 39,802,565 bp
  • T to A, chromosome 19 at 39,802,571 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8094 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067526-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.