Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8099Btlr/Mmmh
Stock Number:
067531-MU
Citation ID:
RRID:MMRRC_067531-MU
Other Names:
R8099 (G1)
Major Collection:

Strain Information

Macf1
Name: microtubule-actin crosslinking factor 1
Synonyms: Acf7, Aclp7, trabeculin alpha
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11426
Homologene: 136191
Prrc2b
Name: proline-rich coiled-coil 2B
Synonyms: 5830434P21Rik, Bat2l
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227723
Homologene: 106649
Sipa1l1
Name: signal-induced proliferation-associated 1 like 1
Synonyms: 4931426N11Rik, Spar
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217692
VEGA: 12
Homologene: 9189
Foxp1
Name: forkhead box P1
Synonyms: 4932443N09Rik, 3110052D19Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 108655
HGNC: HGNC:3823
Homologene: 13092
Ptpn3
Name: protein tyrosine phosphatase, non-receptor type 3
Synonyms: PTPCL, 9530011I20Rik, PTP-H1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 545622
HGNC: HGNC:9655
Homologene: 74451
Trp53bp1
Name: transformation related protein 53 binding protein 1
Synonyms: 53BP1, p53BP1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 27223
Homologene: 4137
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 118,198,791 bp
  • T to C, chromosome 2 at 32,208,674 bp
  • T to A, chromosome 2 at 87,903,508 bp
  • A to C, chromosome 2 at 104,054,935 bp
  • A to G, chromosome 2 at 121,199,749 bp
  • TCTCCTC to TCTC, chromosome 2 at 121,439,456 bp
  • T to C, chromosome 2 at 135,251,734 bp
  • T to C, chromosome 3 at 89,183,943 bp
  • G to A, chromosome 3 at 95,881,344 bp
  • A to T, chromosome 3 at 104,947,092 bp
  • T to G, chromosome 3 at 106,148,668 bp
  • A to G, chromosome 4 at 19,525,169 bp
  • A to T, chromosome 4 at 57,204,985 bp
  • G to T, chromosome 4 at 108,848,374 bp
  • A to T, chromosome 4 at 123,476,129 bp
  • A to T, chromosome 4 at 151,012,557 bp
  • A to G, chromosome 4 at 155,455,032 bp
  • T to C, chromosome 5 at 87,892,440 bp
  • A to T, chromosome 5 at 108,801,834 bp
  • A to T, chromosome 5 at 109,293,319 bp
  • T to A, chromosome 5 at 110,188,707 bp
  • A to G, chromosome 5 at 124,077,245 bp
  • T to C, chromosome 5 at 145,788,402 bp
  • T to C, chromosome 6 at 39,410,097 bp
  • A to T, chromosome 6 at 69,648,914 bp
  • C to T, chromosome 6 at 98,945,549 bp
  • T to C, chromosome 6 at 112,376,477 bp
  • G to A, chromosome 6 at 124,517,725 bp
  • A to T, chromosome 6 at 142,675,531 bp
  • T to C, chromosome 7 at 44,550,322 bp
  • A to T, chromosome 7 at 103,250,288 bp
  • T to A, chromosome 7 at 141,745,438 bp
  • T to G, chromosome 8 at 12,861,973 bp
  • T to A, chromosome 8 at 45,942,093 bp
  • GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA to GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA, chromosome 8 at 109,624,195 bp
  • T to A, chromosome 9 at 58,152,494 bp
  • T to A, chromosome 9 at 66,372,140 bp
  • T to A, chromosome 9 at 70,586,078 bp
  • T to C, chromosome 9 at 90,064,247 bp
  • T to C, chromosome 10 at 123,146,921 bp
  • T to A, chromosome 10 at 129,333,127 bp
  • T to C, chromosome 11 at 46,162,021 bp
  • T to A, chromosome 11 at 72,070,318 bp
  • C to T, chromosome 11 at 77,454,929 bp
  • C to T, chromosome 11 at 85,339,666 bp
  • T to C, chromosome 11 at 88,049,256 bp
  • T to C, chromosome 11 at 98,847,383 bp
  • T to A, chromosome 11 at 105,864,007 bp
  • C to T, chromosome 12 at 82,433,826 bp
  • C to T, chromosome 13 at 23,763,849 bp
  • A to T, chromosome 14 at 31,302,364 bp
  • T to C, chromosome 14 at 70,157,520 bp
  • CAGCTGGAGGAGC to CAGC, chromosome 15 at 78,436,913 bp
  • A to G, chromosome 15 at 86,031,600 bp
  • A to G, chromosome 15 at 98,497,813 bp
  • A to T, chromosome 16 at 17,849,769 bp
  • T to C, chromosome 17 at 18,257,397 bp
  • T to A, chromosome 17 at 69,247,688 bp
  • T to A, chromosome 18 at 12,534,063 bp
  • T to C, chromosome 18 at 57,899,392 bp
  • T to C, chromosome 19 at 44,992,528 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8099 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067531-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.