Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8134Btlr/Mmmh
Stock Number:
067562-MU
Citation ID:
RRID:MMRRC_067562-MU
Other Names:
R8134 (G1)
Major Collection:

Strain Information

Lrrn3
Name: leucine rich repeat protein 3, neuronal
Synonyms: NLRR-3
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 16981
VEGA: 12
Homologene: 36315
Abce1
Name: ATP-binding cassette, sub-family E member 1
Synonyms: RNS4l (Eye), Oabp, Rnaseli
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 24015
HGNC: HGNC:69
Homologene: 2205
Rictor
Name: RPTOR independent companion of MTOR, complex 2
Synonyms: 6030405M08Rik, D530039E11Rik, 4921505C17Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 78757
VEGA: 15
Homologene: 34317
Camsap3
Name: calmodulin regulated spectrin-associated protein family, member 3
Synonyms: Nezha, 2310057J16Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 69697
Homologene: 18966
Phf3
Name: PHD finger protein 3
Synonyms: 2310061N19Rik, AU020177
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 213109
HGNC: HGNC:8921
Homologene: 9040
Numa1
Name: nuclear mitotic apparatus protein 1
Synonyms: 6720401E04Rik, NuMA
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101706
HGNC: HGNC:8059
Homologene: 38150
Ctnnbl1
Name: catenin, beta like 1
Synonyms: NYD-SP19, FLJ21108, P14L, 5730471K09Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66642
Homologene: 12003
Ascc3
Name: activating signal cointegrator 1 complex subunit 3
Synonyms: ASC1p200, B630009I04Rik, Helic1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 77987
VEGA: 10
Homologene: 4973
Kifbp
Name: kinesin family binding protein
Synonyms: 2510003E04Rik, Kif1bp
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 72320
Homologene: 9223
Herc2
Name: HECT and RLD domain containing E3 ubiquitin protein ligase 2
Synonyms: D7H15F32S1, D15F32S1h, D7H15F37S1, rjs, jdf2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 15204
HGNC: HGNC:4868
Homologene: 3430
Plcg2
Name: phospholipase C, gamma 2
Synonyms: Plcg-2, PLCgamma2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234779
HGNC: HGNC:9066
Homologene: 55671
Bard1
Name: BRCA1 associated RING domain 1
Synonyms: ENSMUSG00000060893, ENSMUSG00000073653
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12021
HGNC: HGNC:952
Homologene: 400
Tbc1d15
Name: TBC1 domain family, member 15
Synonyms: 4432405K22Rik, Ly6dl
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 66687
VEGA: 10
Homologene: 11249
C2cd3
Name: C2 calcium-dependent domain containing 3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 277939
Homologene: 19524
Anp32a
Name: acidic nuclear phosphoprotein 32 family member A
Synonyms: pp32, Anp32
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 11737
Homologene: 137229
Casz1
Name: castor zinc finger 1
Synonyms: 2410019P08Rik, D4Ertd432e, castor, Cst
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 69743
Homologene: 9824
Ints2
Name: integrator complex subunit 2
Synonyms: 2810417D08Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 70422
Homologene: 10801
Ppip5k2
Name: diphosphoinositol pentakisphosphate kinase 2
Synonyms: Vip2, Hisppd1, Cfap160
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227399
Homologene: 49409
Ubqln4
Name: ubiquilin 4
Synonyms: UBIN
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 94232
HGNC: HGNC:1237
Homologene: 41346
Vps13a
Name: vacuolar protein sorting 13A
Synonyms: 4930516E05Rik, D330038K10Rik, 4930543C13Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 271564
VEGA: 19
HGNC: HGNC:1908
Homologene: 22068
Ppp1r12b
Name: protein phosphatase 1, regulatory subunit 12B
Synonyms: 1810037O03Rik, 9530009M10Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 329251
HGNC: HGNC:7619
Homologene: 135710
Csmd1
Name: CUB and Sushi multiple domains 1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 94109
Homologene: 69536
Adam20
Name: a disintegrin and metallopeptidase domain 20
Synonyms: 4930529F22Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 384806
Homologene: 128364
Klb
Name: klotho beta
Synonyms: betaKlotho
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 83379
Homologene: 12820
Il20ra
Name: interleukin 20 receptor, alpha
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237313
VEGA: 10
HGNC: HGNC:6003
Homologene: 8685
Magi2
Name: membrane associated guanylate kinase, WW and PDZ domain containing 2
Synonyms: S-SCAM, Acvrinp1, Magi-2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 50791
Homologene: 8189
Ints10
Name: integrator complex subunit 10
Synonyms: 4921521J11Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 70885
Homologene: 10029
Btnl1
Name: butyrophilin-like 1
Synonyms: NG10, LOC240074, LOC240074, Btnl3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 100038862
Homologene: 103816
Cadm4
Name: cell adhesion molecule 4
Synonyms: Tsll2, Igsf4c, SynCAM 4, Necl-4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 260299
Homologene: 17063
Atg9b
Name: autophagy related 9B
Synonyms: LOC213948, Apg9l2, eONE, Nos3as
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 213948
Homologene: 72638
Hpd
Name: 4-hydroxyphenylpyruvic acid dioxygenase
Synonyms: Hppd, Laf, Flp, Fla
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 15445
HGNC: HGNC:5147
Homologene: 1620
Or2bd2
Name: olfactory receptor family 2 subfamily BD member 2
Synonyms: GA_x6K02T2QGBW-3169916-3170881, MOR124-1, 4930415J05Rik, Olfr1344
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 257882
Zfp217
Name: zinc finger protein 217
Synonyms: 4933431C08Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228913
Homologene: 4757
Col11a1
Name: collagen, type XI, alpha 1
Synonyms: C530001D20Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 12814
HGNC: HGNC:2186
Homologene: 56389
Ninl
Name: ninein-like
Synonyms: LOC381388, LOC381387, 4930519N13Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 78177
Homologene: 57024
Map3k19
Name: mitogen-activated protein kinase kinase kinase 19
Synonyms: Ysk4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22625
Homologene: 19318
Cpne9
Name: copine family member IX
Synonyms: A730016F12Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 211232
Homologene: 84686
Scaf11
Name: SR-related CTD-associated factor 11
Synonyms: 1110061H03Rik, SRRP129, CASP11, SIP1, 2610510E10Rik, Sfrs2ip, Srsf2ip
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 72193
VEGA: 15
Homologene: 37957
Rrs1
Name: ribosome biogenesis regulator 1
Synonyms: 5730466A07Rik, D1Ertd701e
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 59014
Homologene: 41014
Nfe2l1
Name: nuclear factor, erythroid derived 2,-like 1
Synonyms: TCF-11, NRF1, LCR-F1, TCF11, Lcrf1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18023
HGNC: HGNC:7781
Homologene: 20685
Kdm4d
Name: lysine (K)-specific demethylase 4D
Synonyms: Jmjd2d
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 244694
Homologene: 69244
Svop
Name: SV2 related protein
Synonyms: 1110030H18Rik, msvop
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 68666
Homologene: 41283
Pnpla1
Name: patatin-like phospholipase domain containing 1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 433091
Homologene: 25324
Kndc1
Name: kinase non-catalytic C-lobe domain (KIND) containing 1
Synonyms: VKIND, very-kind, 2410012C07Rik, B830014K08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 76484
Homologene: 45138
Spaca1
Name: sperm acrosome associated 1
Synonyms: 1700124L11Rik, 4930540L03Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 67652
Homologene: 12170
Cd38
Name: CD38 antigen
Synonyms: Cd38-rs1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12494
HGNC: HGNC:1667
Homologene: 1345
Ube2z
Name: ubiquitin-conjugating enzyme E2Z
Synonyms: C030047H17Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268470
Homologene: 11319
Ms4a3
Name: membrane-spanning 4-domains, subfamily A, member 3
Synonyms: haematopoietic cell-specific transmembrane-4, HTm4
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 170813
HGNC: HGNC:7317
Homologene: 4472
Or13a25
Name: olfactory receptor family 13 subfamily A member 25
Synonyms: GA_x6K02T2PBJ9-42813436-42814368, MOR253-4, Olfr539
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258963
Homologene: 79393
Jhy
Name: junctional cadherin complex regulator
Synonyms: 4931429I11Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 70989
Homologene: 11726
Krtap4-1
Name: keratin associated protein 4-1
Synonyms: A030010K20Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 665891
Cdk20
Name: cyclin dependent kinase 20
Synonyms: 4932702G04Rik, Ccrk
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 105278
VEGA: 13
Homologene: 8109
Gm15922
Name: predicted gene 15922
Type: Gene
Species: Mouse
Chromosome: 7
Sun3
Name: Sad1 and UNC84 domain containing 3
Synonyms: D630047F21Rik, Sunc1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 194974
Homologene: 51273
Cfap54
Name: cilia and flagella associated protein 54
Synonyms: LOC380653, Gm872, 4930485B16Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 380654
Homologene: 133438
Hoxa4
Name: homeobox A4
Synonyms: Hox-1.4
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 15401
HGNC: HGNC:5105
Homologene: 37583
Pcdhgc3
Name: protocadherin gamma subfamily C, 3
Synonyms: PC43, Pcdh2
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93706
HGNC: HGNC:8716
Homologene: 31099
Frmpd2
Name: FERM and PDZ domain containing 2
Synonyms: LOC380890, LOC268729, Frmpd2, ENSMUSG00000071536, Gm626
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 268729
Homologene: 51854
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 9,545,420 bp
  • A to G, chromosome 1 at 30,824,471 bp
  • A to T, chromosome 1 at 71,067,138 bp
  • A to T, chromosome 1 at 97,745,163 bp
  • A to C, chromosome 1 at 127,823,755 bp
  • T to C, chromosome 1 at 134,886,542 bp
  • C to T, chromosome 2 at 115,866,888 bp
  • C to T, chromosome 2 at 150,950,314 bp
  • T to C, chromosome 2 at 157,809,471 bp
  • G to A, chromosome 2 at 170,119,651 bp
  • G to A, chromosome 3 at 88,555,490 bp
  • A to G, chromosome 3 at 114,218,786 bp
  • T to A, chromosome 4 at 34,042,157 bp
  • C to T, chromosome 4 at 148,943,035 bp
  • T to G, chromosome 5 at 20,391,367 bp
  • T to A, chromosome 5 at 20,391,394 bp
  • A to G, chromosome 5 at 24,385,222 bp
  • C to A, chromosome 5 at 43,901,448 bp
  • A to T, chromosome 5 at 65,383,615 bp
  • C to T, chromosome 5 at 114,042,931 bp
  • G to T, chromosome 5 at 123,174,380 bp
  • G to T, chromosome 6 at 52,190,557 bp
  • A to T, chromosome 6 at 113,295,042 bp
  • T to A, chromosome 6 at 121,221,422 bp
  • A to G, chromosome 7 at 3,735,839 bp
  • T to C, chromosome 7 at 6,438,923 bp
  • A to T, chromosome 7 at 24,303,741 bp
  • A to G, chromosome 7 at 24,503,605 bp
  • C to T, chromosome 7 at 56,085,136 bp
  • A to T, chromosome 7 at 100,418,504 bp
  • T to C, chromosome 7 at 102,001,627 bp
  • T to A, chromosome 7 at 139,901,369 bp
  • T to A, chromosome 7 at 140,667,767 bp
  • A to G, chromosome 8 at 3,598,075 bp
  • A to T, chromosome 8 at 15,932,550 bp
  • A to G, chromosome 8 at 40,796,064 bp
  • T to A, chromosome 8 at 68,802,986 bp
  • G to A, chromosome 8 at 79,699,353 bp
  • A to T, chromosome 8 at 117,557,318 bp
  • C to T, chromosome 9 at 14,463,236 bp
  • A to G, chromosome 9 at 40,960,892 bp
  • G to T, chromosome 9 at 62,377,581 bp
  • A to G, chromosome 10 at 19,750,704 bp
  • A to G, chromosome 10 at 50,767,458 bp
  • T to C, chromosome 10 at 62,577,977 bp
  • A to T, chromosome 10 at 92,878,516 bp
  • A to T, chromosome 10 at 115,209,569 bp
  • G to T, chromosome 11 at 9,029,346 bp
  • A to G, chromosome 11 at 86,212,660 bp
  • A to G, chromosome 11 at 96,058,374 bp
  • A to T, chromosome 11 at 96,819,759 bp
  • GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC to GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC, chromosome 11 at 99,627,834 bp
  • T to C, chromosome 12 at 41,453,048 bp
  • A to G, chromosome 13 at 64,437,920 bp
  • T to C, chromosome 14 at 33,505,495 bp
  • C to T, chromosome 15 at 6,772,154 bp
  • T to C, chromosome 15 at 96,420,711 bp
  • A to G, chromosome 17 at 28,878,469 bp
  • A to G, chromosome 17 at 34,385,673 bp
  • A to T, chromosome 17 at 43,626,173 bp
  • G to A, chromosome 18 at 37,806,863 bp
  • G to C, chromosome 19 at 11,638,249 bp
  • A to G, chromosome 19 at 16,654,354 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8134 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067562-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.