Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8134Btlr/Mmmh
Stock Number:
067562-MU
Citation ID:
RRID:MMRRC_067562-MU
Other Names:
R8134 (G1)
Major Collection:

Strain Information

Lrrn3
Name: leucine rich repeat protein 3, neuronal
Synonyms: NLRR-3
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 16981
VEGA: 12
Homologene: 36315
Abce1
Name: ATP-binding cassette, sub-family E member 1
Synonyms: RNS4l (Eye), Oabp, Rnaseli
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 24015
HGNC: HGNC:69
Homologene: 2205
Rictor
Name: RPTOR independent companion of MTOR, complex 2
Synonyms: 6030405M08Rik, D530039E11Rik, 4921505C17Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 78757
VEGA: 15
Homologene: 34317
Camsap3
Name: calmodulin regulated spectrin-associated protein family, member 3
Synonyms: Nezha, 2310057J16Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 69697
Homologene: 18966
Phf3
Name: PHD finger protein 3
Synonyms: 2310061N19Rik, AU020177
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 213109
HGNC: HGNC:8921
Homologene: 9040
Numa1
Name: nuclear mitotic apparatus protein 1
Synonyms: 6720401E04Rik, NuMA
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101706
HGNC: HGNC:8059
Homologene: 38150
Ctnnbl1
Name: catenin, beta like 1
Synonyms: NYD-SP19, FLJ21108, P14L, 5730471K09Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66642
Homologene: 12003
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 9,545,420 bp
  • A to G, chromosome 1 at 30,824,471 bp
  • A to T, chromosome 1 at 71,067,138 bp
  • A to T, chromosome 1 at 97,745,163 bp
  • A to C, chromosome 1 at 127,823,755 bp
  • T to C, chromosome 1 at 134,886,542 bp
  • C to T, chromosome 2 at 115,866,888 bp
  • C to T, chromosome 2 at 150,950,314 bp
  • T to C, chromosome 2 at 157,809,471 bp
  • G to A, chromosome 2 at 170,119,651 bp
  • G to A, chromosome 3 at 88,555,490 bp
  • A to G, chromosome 3 at 114,218,786 bp
  • T to A, chromosome 4 at 34,042,157 bp
  • C to T, chromosome 4 at 148,943,035 bp
  • T to G, chromosome 5 at 20,391,367 bp
  • T to A, chromosome 5 at 20,391,394 bp
  • A to G, chromosome 5 at 24,385,222 bp
  • C to A, chromosome 5 at 43,901,448 bp
  • A to T, chromosome 5 at 65,383,615 bp
  • C to T, chromosome 5 at 114,042,931 bp
  • G to T, chromosome 5 at 123,174,380 bp
  • G to T, chromosome 6 at 52,190,557 bp
  • A to T, chromosome 6 at 113,295,042 bp
  • T to A, chromosome 6 at 121,221,422 bp
  • A to G, chromosome 7 at 3,735,839 bp
  • T to C, chromosome 7 at 6,438,923 bp
  • A to T, chromosome 7 at 24,303,741 bp
  • A to G, chromosome 7 at 24,503,605 bp
  • C to T, chromosome 7 at 56,085,136 bp
  • A to T, chromosome 7 at 100,418,504 bp
  • T to C, chromosome 7 at 102,001,627 bp
  • T to A, chromosome 7 at 139,901,369 bp
  • T to A, chromosome 7 at 140,667,767 bp
  • A to G, chromosome 8 at 3,598,075 bp
  • A to T, chromosome 8 at 15,932,550 bp
  • A to G, chromosome 8 at 40,796,064 bp
  • T to A, chromosome 8 at 68,802,986 bp
  • G to A, chromosome 8 at 79,699,353 bp
  • A to T, chromosome 8 at 117,557,318 bp
  • C to T, chromosome 9 at 14,463,236 bp
  • A to G, chromosome 9 at 40,960,892 bp
  • G to T, chromosome 9 at 62,377,581 bp
  • A to G, chromosome 10 at 19,750,704 bp
  • A to G, chromosome 10 at 50,767,458 bp
  • T to C, chromosome 10 at 62,577,977 bp
  • A to T, chromosome 10 at 92,878,516 bp
  • A to T, chromosome 10 at 115,209,569 bp
  • G to T, chromosome 11 at 9,029,346 bp
  • A to G, chromosome 11 at 86,212,660 bp
  • A to G, chromosome 11 at 96,058,374 bp
  • A to T, chromosome 11 at 96,819,759 bp
  • GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC to GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC, chromosome 11 at 99,627,834 bp
  • T to C, chromosome 12 at 41,453,048 bp
  • A to G, chromosome 13 at 64,437,920 bp
  • T to C, chromosome 14 at 33,505,495 bp
  • C to T, chromosome 15 at 6,772,154 bp
  • T to C, chromosome 15 at 96,420,711 bp
  • A to G, chromosome 17 at 28,878,469 bp
  • A to G, chromosome 17 at 34,385,673 bp
  • A to T, chromosome 17 at 43,626,173 bp
  • G to A, chromosome 18 at 37,806,863 bp
  • G to C, chromosome 19 at 11,638,249 bp
  • A to G, chromosome 19 at 16,654,354 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8134 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067562-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.