Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8138Btlr/Mmmh
Stock Number:
067566-MU
Citation ID:
RRID:MMRRC_067566-MU
Other Names:
R8138 (G1)
Major Collection:

Strain Information

Srebf2
Name: sterol regulatory element binding factor 2
Synonyms: SREBP-2, nuc, SREBP2, SREBP2gc, bHLHd2, lop13
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 20788
VEGA: 15
Homologene: 20966
Bzw2
Name: basic leucine zipper and W2 domains 2
Synonyms: HSPC028, 1110001I24Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 66912
VEGA: 12
Homologene: 8530
Akap13
Name: A kinase anchor protein 13
Synonyms: AKAP-Lbc, PROTO-LBC, PROTO-LB, Ht31, 5730522G15Rik, 1700026G02Rik, 5830460E08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 75547
HGNC: HGNC:371
Homologene: 4903
Trit1
Name: tRNA isopentenyltransferase 1
Synonyms: MOD5, 2310075G14Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 66966
Homologene: 7010
Lmtk2
Name: lemur tyrosine kinase 2
Synonyms: 2900041G10Rik, KPI-2, cprk, KPI2, A330101P12Rik, BREK, AATYK2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231876
Homologene: 8948
Fgd6
Name: FYVE, RhoGEF and PH domain containing 6
Synonyms: ZFYVE24, Etohd4
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 13998
Homologene: 14209
C1qtnf2
Name: C1q and tumor necrosis factor related protein 2
Synonyms: 1810033K05Rik, CTRP2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 69183
Homologene: 12899
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • GGGAGGCGGCGGCGGCGGCAGCGGAGGAGGCGGCGGCGGC to GGGAGGAGGCGGCGGCGGC, chromosome 1 at 9,748,109 bp
  • T to C, chromosome 1 at 34,557,999 bp
  • C to T, chromosome 1 at 52,709,512 bp
  • C to T, chromosome 1 at 139,441,807 bp
  • A to G, chromosome 2 at 52,175,695 bp
  • T to C, chromosome 2 at 82,975,797 bp
  • T to C, chromosome 2 at 86,347,586 bp
  • A to G, chromosome 2 at 102,832,497 bp
  • A to G, chromosome 2 at 174,298,386 bp
  • G to A, chromosome 4 at 123,043,789 bp
  • G to A, chromosome 4 at 123,743,445 bp
  • T to C, chromosome 5 at 43,235,009 bp
  • A to G, chromosome 5 at 93,043,483 bp
  • C to T, chromosome 5 at 144,175,597 bp
  • A to G, chromosome 6 at 56,957,406 bp
  • A to G, chromosome 6 at 113,482,539 bp
  • A to G, chromosome 6 at 124,905,492 bp
  • A to T, chromosome 7 at 10,715,531 bp
  • A to T, chromosome 7 at 13,261,411 bp
  • T to A, chromosome 7 at 29,775,372 bp
  • T to A, chromosome 7 at 75,702,231 bp
  • C to A, chromosome 7 at 79,098,427 bp
  • T to A, chromosome 7 at 103,552,059 bp
  • A to T, chromosome 7 at 108,103,557 bp
  • A to G, chromosome 8 at 24,781,762 bp
  • T to C, chromosome 8 at 26,125,981 bp
  • T to C, chromosome 8 at 71,492,598 bp
  • C to A, chromosome 9 at 105,669,035 bp
  • A to T, chromosome 9 at 120,051,583 bp
  • A to T, chromosome 10 at 18,169,405 bp
  • A to G, chromosome 10 at 25,536,041 bp
  • A to G, chromosome 10 at 94,134,143 bp
  • CACCATGGCTGCTACCATGGCTGCT to CACCATGGCTGCT, chromosome 11 at 5,104,303 bp
  • G to A, chromosome 11 at 43,486,011 bp
  • G to T, chromosome 11 at 50,833,448 bp
  • T to C, chromosome 12 at 30,074,104 bp
  • T to C, chromosome 12 at 36,109,820 bp
  • A to G, chromosome 12 at 70,042,898 bp
  • C to T, chromosome 13 at 54,598,783 bp
  • A to G, chromosome 13 at 64,176,070 bp
  • A to G, chromosome 13 at 81,711,650 bp
  • C to T, chromosome 14 at 54,211,525 bp
  • T to C, chromosome 15 at 76,691,721 bp
  • C to T, chromosome 15 at 82,178,765 bp
  • A to G, chromosome 15 at 98,843,653 bp
  • A to G, chromosome 16 at 8,600,965 bp
  • A to G, chromosome 16 at 14,472,887 bp
  • A to T, chromosome 17 at 12,701,238 bp
  • T to A, chromosome 17 at 18,063,348 bp
  • T to C, chromosome 18 at 10,533,060 bp
  • G to A, chromosome 19 at 12,269,072 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8138 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067566-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.