Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8138Btlr/Mmmh
Stock Number:
067566-MU
Citation ID:
RRID:MMRRC_067566-MU
Other Names:
R8138 (G1)
Major Collection:

Strain Information

Srebf2
Name: sterol regulatory element binding factor 2
Synonyms: SREBP-2, nuc, SREBP2, SREBP2gc, bHLHd2, lop13
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 20788
VEGA: 15
Homologene: 20966
Bzw2
Name: basic leucine zipper and W2 domains 2
Synonyms: HSPC028, 1110001I24Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 66912
VEGA: 12
Homologene: 8530
Akap13
Name: A kinase anchor protein 13
Synonyms: AKAP-Lbc, PROTO-LBC, PROTO-LB, Ht31, 5730522G15Rik, 1700026G02Rik, 5830460E08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 75547
HGNC: HGNC:371
Homologene: 4903
Trit1
Name: tRNA isopentenyltransferase 1
Synonyms: MOD5, 2310075G14Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 66966
Homologene: 7010
Lmtk2
Name: lemur tyrosine kinase 2
Synonyms: 2900041G10Rik, KPI-2, cprk, KPI2, A330101P12Rik, BREK, AATYK2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231876
Homologene: 8948
Fgd6
Name: FYVE, RhoGEF and PH domain containing 6
Synonyms: ZFYVE24, Etohd4
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 13998
Homologene: 14209
C1qtnf2
Name: C1q and tumor necrosis factor related protein 2
Synonyms: 1810033K05Rik, CTRP2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 69183
Homologene: 12899
Il17rc
Name: interleukin 17 receptor C
Synonyms: IL17-RL, Il17rl, 1110025H02Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 171095
Homologene: 15894
Igf2r
Name: insulin-like growth factor 2 receptor
Synonyms: Mpr300, CI-MPR, IGF-II/CI-MPR, M6P/IGF2R, CD222, mannose-6-phosphate receptor, cation independent
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 16004
HGNC: HGNC:5467
Homologene: 676
Cx3cr1
Name: C-X3-C motif chemokine receptor 1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 13051
VEGA: 9
HGNC: HGNC:2558
Homologene: 20350
Zbtb41
Name: zinc finger and BTB domain containing 41
Synonyms: 8430415N23Rik, 9830132G07Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226470
Homologene: 27795
Pik3r4
Name: phosphoinositide-3-kinase regulatory subunit 4
Synonyms: Vps15, p150
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 75669
HGNC: HGNC:8982
Homologene: 24678
Fsip2
Name: fibrous sheath-interacting protein 2
Synonyms: OTTMUSG00000013335
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241516
Homologene: 110349
Tpo
Name: thyroid peroxidase
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 22018
Homologene: 461
Ect2l
Name: epithelial cell transforming sequence 2 oncogene-like
Synonyms: Gm10331, C330021H03Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 100045792
Homologene: 46005
Mfsd6
Name: major facilitator superfamily domain containing 6
Synonyms: 9630025I22Rik, MMR2, 2210010L05Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98682
Homologene: 9784
Or51ab3
Name: olfactory receptor family 51 subfamily AB member 3
Synonyms: GA_x6K02T2PBJ9-6275524-6276477, GA_x6K02T2PBJ9-6271959-6272393, MOR20-1, MOR20-1, Olfr614, Olfr613
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259104
Homologene: 17505
Nlrp4b
Name: NLR family, pyrin domain containing 4B
Synonyms: Nalp-gamma, Nalp4b
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 210045
Homologene: 65242
Ppp1r16a
Name: protein phosphatase 1, regulatory subunit 16A
Synonyms: 2900084E10Rik, Mypt3, R75527
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 73062
Homologene: 13161
Adam5
Name: a disintegrin and metallopeptidase domain 5
Synonyms: tMDCII
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 11499
HGNC: HGNC:212
Homologene: 49138
Kmt2d
Name: lysine (K)-specific methyltransferase 2D
Synonyms: C430014K11Rik, Mll4, Mll2, bapa
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 381022
HGNC: HGNC:7133
Homologene: 86893
Greb1l
Name: growth regulation by estrogen in breast cancer-like
Synonyms: mKIAA4095, AK220484
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 381157
Homologene: 73393
Or8k53
Name: olfactory receptor family 8 subfamily K member 53
Synonyms: GA_x6K02T2Q125-47819205-47818258, MOR186-1, Olfr1055
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 259023
Homologene: 131140
Cpeb2
Name: cytoplasmic polyadenylation element binding protein 2
Synonyms: A630055H10Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231207
Homologene: 17995
Zfp879
Name: zinc finger protein 879
Synonyms: 9630041N07Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 214779
Homologene: 45452
Nin
Name: ninein
Synonyms: 3110068G20Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 18080
Homologene: 40632
Vcpip1
Name: valosin containing protein (p97)/p47 complex interacting protein 1
Synonyms: 5730421J18Rik, 5730538E15Rik, Vcip135
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 70675
Homologene: 11814
Gtpbp3
Name: GTP binding protein 3
Synonyms: Gtpbp3, 2410009F13Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 70359
Homologene: 6600
Acan
Name: aggrecan
Synonyms: Cspg1, Agc1, b2b183Clo
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11595
HGNC: HGNC:319
Homologene: 137204
Prss40
Name: serine protease 40
Synonyms: Tesp2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 21756
Homologene: 69043
Abcc1
Name: ATP-binding cassette, sub-family C member 1
Synonyms: MRP, Mdrap, Mrp1, Abcc1b, Abcc1a
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 17250
HGNC: HGNC:51
Homologene: 133779
Vmn2r124
Name: vomeronasal 2, receptor 124
Synonyms: Gm7196, Vmn2r-ps113
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 637021
Homologene: 115024
Rnf170
Name: ring finger protein 170
Synonyms: 6720407G21Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 77733
Homologene: 12807
Vmn1r4
Name: vomeronasal 1 receptor 4
Synonyms: C230065D10Rik, V1rc21
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 171194
Homologene: 131060
Gnas
Name: GNAS complex locus
Synonyms: Gnas1, Gs-alpha, Gs alpha, G alpha s, Nesp55, P2, P3, P1, neuroendocrine-specific Golgi protein p55 isoform 1, XLalphas, Gsa, Nesp, Gnasxl, Nespl, Oedsml, Galphas, SCG6
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14683
HGNC: HGNC:4392
Homologene: 55534
Zswim9
Name: zinc finger SWIM-type containing 9
Synonyms: 6330408A02Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 321008
Homologene: 52386
Zfp84
Name: zinc finger protein 84
Synonyms: C86188, Zfp69, KRAB18, 4633401C23Rik, 2210410P13Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74352
Homologene: 51858
Or5p59
Name: olfactory receptor family 5 subfamily P member 59
Synonyms: GA_x6K02T2PBJ9-10432095-10433042, MOR204-12, Olfr483
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258730
Homologene: 133602
Sowahb
Name: sosondowah ankyrin repeat domain family member B
Synonyms: 5730467H21Rik, Ankrd56
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 78088
Homologene: 18429
Or5an11
Name: olfactory receptor family 5 subfamily AN member 11
Synonyms: GA_x6K02T2LL2P-1028-792, GA_x6K02T057QT-4025-4642, GA_x6K02T03CT6-1-477, MOR214-3, MOR214-3, Olfr245, Olfr232, Olfr235
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258681
Mblac2
Name: metallo-beta-lactamase domain containing 2
Synonyms: 2900024O10Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 72852
VEGA: 13
Homologene: 15174
Rhbdd3
Name: rhomboid domain containing 3
Synonyms: 5730411O18Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 279766
HGNC: HGNC:1308
Homologene: 8175
Akirin1
Name: akirin 1
Synonyms: 6330407G11Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 68050
Homologene: 11348
Lag3
Name: lymphocyte-activation gene 3
Synonyms: CD223, Ly66, LAG-3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16768
HGNC: HGNC:6476
Homologene: 1719
Habp4
Name: hyaluronic acid binding protein 4
Synonyms: 4933413D03Rik, 4933428J01Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 56541
VEGA: 13
Homologene: 8615
Cltb
Name: clathrin light chain B
Synonyms: 2310046E19Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 74325
HGNC: HGNC:2091
Homologene: 37532
Abat
Name: 4-aminobutyrate aminotransferase
Synonyms: 9630038C02Rik, GABA-T
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 268860
HGNC: HGNC:23
Homologene: 542
Traj7
Name: T cell receptor alpha joining 7
Synonyms: Gm16919
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 100124396
Smlr1
Name: small leucine-rich protein 1
Synonyms: 2010003K15Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 100504474
Homologene: 133233
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • GGGAGGCGGCGGCGGCGGCAGCGGAGGAGGCGGCGGCGGC to GGGAGGAGGCGGCGGCGGC, chromosome 1 at 9,748,109 bp
  • T to C, chromosome 1 at 34,557,999 bp
  • C to T, chromosome 1 at 52,709,512 bp
  • C to T, chromosome 1 at 139,441,807 bp
  • A to G, chromosome 2 at 52,175,695 bp
  • T to C, chromosome 2 at 82,975,797 bp
  • T to C, chromosome 2 at 86,347,586 bp
  • A to G, chromosome 2 at 102,832,497 bp
  • A to G, chromosome 2 at 174,298,386 bp
  • G to A, chromosome 4 at 123,043,789 bp
  • G to A, chromosome 4 at 123,743,445 bp
  • T to C, chromosome 5 at 43,235,009 bp
  • A to G, chromosome 5 at 93,043,483 bp
  • C to T, chromosome 5 at 144,175,597 bp
  • A to G, chromosome 6 at 56,957,406 bp
  • A to G, chromosome 6 at 113,482,539 bp
  • A to G, chromosome 6 at 124,905,492 bp
  • A to T, chromosome 7 at 10,715,531 bp
  • A to T, chromosome 7 at 13,261,411 bp
  • T to A, chromosome 7 at 29,775,372 bp
  • T to A, chromosome 7 at 75,702,231 bp
  • C to A, chromosome 7 at 79,098,427 bp
  • T to A, chromosome 7 at 103,552,059 bp
  • A to T, chromosome 7 at 108,103,557 bp
  • A to G, chromosome 8 at 24,781,762 bp
  • T to C, chromosome 8 at 26,125,981 bp
  • T to C, chromosome 8 at 71,492,598 bp
  • C to A, chromosome 9 at 105,669,035 bp
  • A to T, chromosome 9 at 120,051,583 bp
  • A to T, chromosome 10 at 18,169,405 bp
  • A to G, chromosome 10 at 25,536,041 bp
  • A to G, chromosome 10 at 94,134,143 bp
  • CACCATGGCTGCTACCATGGCTGCT to CACCATGGCTGCT, chromosome 11 at 5,104,303 bp
  • G to A, chromosome 11 at 43,486,011 bp
  • G to T, chromosome 11 at 50,833,448 bp
  • T to C, chromosome 12 at 30,074,104 bp
  • T to C, chromosome 12 at 36,109,820 bp
  • A to G, chromosome 12 at 70,042,898 bp
  • C to T, chromosome 13 at 54,598,783 bp
  • A to G, chromosome 13 at 64,176,070 bp
  • A to G, chromosome 13 at 81,711,650 bp
  • C to T, chromosome 14 at 54,211,525 bp
  • T to C, chromosome 15 at 76,691,721 bp
  • C to T, chromosome 15 at 82,178,765 bp
  • A to G, chromosome 15 at 98,843,653 bp
  • A to G, chromosome 16 at 8,600,965 bp
  • A to G, chromosome 16 at 14,472,887 bp
  • A to T, chromosome 17 at 12,701,238 bp
  • T to A, chromosome 17 at 18,063,348 bp
  • T to C, chromosome 18 at 10,533,060 bp
  • G to A, chromosome 19 at 12,269,072 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8138 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067566-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.