Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8194Btlr/Mmmh
Stock Number:
067617-MU
Citation ID:
RRID:MMRRC_067617-MU
Other Names:
R8194 (G1)
Major Collection:

Strain Information

Prkar2a
Name: protein kinase, cAMP dependent regulatory, type II alpha
Synonyms: RII(alpha), 1110061A24Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 19087
HGNC: HGNC:9391
Homologene: 3064
Nedd4
Name: neural precursor cell expressed, developmentally down-regulated 4
Synonyms: Nedd4-1, Nedd4, Nedd4a, E430025J12Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17999
HGNC: HGNC:7727
Homologene: 134533
Slc6a6
Name: solute carrier family 6 (neurotransmitter transporter, taurine), member 6
Synonyms: Taut
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 21366
Homologene: 2291
Slc32a1
Name: solute carrier family 32 (GABA vesicular transporter), member 1
Synonyms: R75019, VGAT, Viaat
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22348
Homologene: 56451
Mapk8
Name: mitogen-activated protein kinase 8
Synonyms: JNK1, c-Jun N-terminal kinase, Prkm8
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 26419
HGNC: HGNC:6881
Homologene: 56760
Cnst
Name: consortin, connexin sorting protein
Synonyms: 9630058J23Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226744
Homologene: 17139
Plekhm1
Name: pleckstrin homology domain containing, family M (with RUN domain) member 1
Synonyms: D330036J23Rik, AP162, B2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 353047
Homologene: 8871
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 9,916,642 bp
  • T to A, chromosome 1 at 93,785,972 bp
  • A to T, chromosome 1 at 136,077,692 bp
  • A to G, chromosome 1 at 179,610,194 bp
  • T to A, chromosome 1 at 189,682,403 bp
  • A to G, chromosome 2 at 15,925,120 bp
  • CT to CTT, chromosome 2 at 26,327,352 bp
  • C to T, chromosome 2 at 28,078,318 bp
  • T to C, chromosome 2 at 158,613,841 bp
  • T to A, chromosome 3 at 89,052,755 bp
  • G to T, chromosome 3 at 146,489,859 bp
  • T to C, chromosome 4 at 62,053,484 bp
  • A to G, chromosome 4 at 133,613,854 bp
  • T to C, chromosome 4 at 134,134,089 bp
  • A to T, chromosome 5 at 57,720,336 bp
  • T to C, chromosome 6 at 42,675,302 bp
  • A to T, chromosome 6 at 91,740,971 bp
  • A to G, chromosome 7 at 24,276,054 bp
  • A to G, chromosome 7 at 26,814,734 bp
  • T to C, chromosome 7 at 30,023,333 bp
  • T to C, chromosome 7 at 80,361,018 bp
  • C to A, chromosome 7 at 99,926,444 bp
  • T to A, chromosome 7 at 103,418,200 bp
  • C to T, chromosome 7 at 127,539,197 bp
  • T to C, chromosome 7 at 128,271,156 bp
  • G to T, chromosome 7 at 141,704,252 bp
  • A to T, chromosome 8 at 119,407,593 bp
  • T to C, chromosome 9 at 20,500,314 bp
  • A to T, chromosome 9 at 31,131,625 bp
  • A to G, chromosome 9 at 72,686,107 bp
  • T to G, chromosome 9 at 86,755,613 bp
  • G to A, chromosome 9 at 108,692,511 bp
  • A to G, chromosome 10 at 39,078,720 bp
  • T to A, chromosome 10 at 58,455,925 bp
  • A to G, chromosome 10 at 81,591,054 bp
  • A to G, chromosome 10 at 83,580,299 bp
  • A to G, chromosome 11 at 67,092,002 bp
  • A to T, chromosome 11 at 73,965,414 bp
  • G to A, chromosome 11 at 100,563,676 bp
  • A to G, chromosome 11 at 103,395,060 bp
  • A to C, chromosome 12 at 69,598,824 bp
  • T to A, chromosome 12 at 71,060,115 bp
  • T to C, chromosome 12 at 111,592,683 bp
  • A to T, chromosome 14 at 33,382,284 bp
  • G to A, chromosome 14 at 36,896,263 bp
  • A to G, chromosome 15 at 28,453,268 bp
  • ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT to ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT, chromosome 15 at 76,002,775 bp
  • G to T, chromosome 15 at 82,390,437 bp
  • A to G, chromosome 16 at 18,218,380 bp
  • T to C, chromosome 17 at 12,922,734 bp
  • G to A, chromosome 17 at 17,374,475 bp
  • A to T, chromosome 17 at 45,633,399 bp
  • A to T, chromosome 18 at 52,639,157 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8194 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067617-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.