Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8194Btlr/Mmmh
Stock Number:
067617-MU
Citation ID:
RRID:MMRRC_067617-MU
Other Names:
R8194 (G1)
Major Collection:

Strain Information

Prkar2a
Name: protein kinase, cAMP dependent regulatory, type II alpha
Synonyms: RII(alpha), 1110061A24Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 19087
HGNC: HGNC:9391
Homologene: 3064
Nedd4
Name: neural precursor cell expressed, developmentally down-regulated 4
Synonyms: Nedd4-1, Nedd4, Nedd4a, E430025J12Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17999
HGNC: HGNC:7727
Homologene: 134533
Slc6a6
Name: solute carrier family 6 (neurotransmitter transporter, taurine), member 6
Synonyms: Taut
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 21366
Homologene: 2291
Slc32a1
Name: solute carrier family 32 (GABA vesicular transporter), member 1
Synonyms: R75019, VGAT, Viaat
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22348
Homologene: 56451
Mapk8
Name: mitogen-activated protein kinase 8
Synonyms: JNK1, c-Jun N-terminal kinase, Prkm8
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 26419
HGNC: HGNC:6881
Homologene: 56760
Cnst
Name: consortin, connexin sorting protein
Synonyms: 9630058J23Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226744
Homologene: 17139
Plekhm1
Name: pleckstrin homology domain containing, family M (with RUN domain) member 1
Synonyms: D330036J23Rik, AP162, B2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 353047
Homologene: 8871
Chd1
Name: chromodomain helicase DNA binding protein 1
Synonyms: 4930525N21Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12648
HGNC: HGNC:1915
Homologene: 68174
Zfp568
Name: zinc finger protein 568
Synonyms: LOC381866, chato
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243905
Homologene: 136307
Rnf169
Name: ring finger protein 169
Synonyms: 2900057K09Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 108937
Homologene: 47510
Cenpf
Name: centromere protein F
Synonyms: 6530404A22Rik, Lek1, mitosin
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 108000
HGNC: HGNC:1857
Homologene: 22969
Mark3
Name: MAP/microtubule affinity regulating kinase 3
Synonyms: ETK-1, 1600015G02Rik, A430080F22Rik, C-TAK1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 17169
VEGA: 12
HGNC: HGNC:6897
Homologene: 55653
Cep85
Name: centrosomal protein 85
Synonyms: 2410030J07Rik, Ccdc21
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 70012
Homologene: 11254
Arid4a
Name: AT-rich interaction domain 4A
Synonyms: A630067N03Rik, Rbbp1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238247
HGNC: HGNC:9885
Homologene: 11303
Fam83h
Name: family with sequence similarity 83, member H
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 105732
VEGA: 15
Homologene: 15890
Ash1l
Name: ASH1 like histone lysine methyltransferase
Synonyms: chromatin remodeling factor, 8030453L17Rik, E430018P19Rik, KMT2H
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 192195
Homologene: 10225
Ccser2
Name: coiled-coil serine rich 2
Synonyms: 1700012P13Rik, 2900054P12Rik, Gcap14
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 72972
Homologene: 10367
Gpsm1
Name: G-protein signalling modulator 1 (AGS3-like, C. elegans)
Synonyms: 1810037C22Rik, Ags3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 67839
Homologene: 16987
Zdhhc18
Name: zinc finger, DHHC domain containing 18
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 503610
Homologene: 110918
Muc2
Name: mucin 2
Synonyms: 2010015E03Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17831
HGNC: HGNC:7512
Homologene: 136755
Tcp1
Name: t-complex protein 1
Synonyms: Ccta, c-cpn, TRic, CCT, Tcp-1, Tp63, p63, Cct1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 21454
Homologene: 5656
St14
Name: suppression of tumorigenicity 14 (colon carcinoma)
Synonyms: Prss14, Epithin, MT-SP1, matriptase, Tmprss14
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 19143
Homologene: 7906
Zfp266
Name: zinc finger protein 266
Synonyms: 5330440G10Rik, 5730601F06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 77519
Homologene: 105676
Prss35
Name: serine protease 35
Synonyms: 6030424L22Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 244954
Homologene: 17734
Srcap
Name: Snf2-related CREBBP activator protein
Synonyms: F630004O05Rik, B930091H02Rik, D030022P06Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100043597
Homologene: 38213
Slc5a2
Name: solute carrier family 5 (sodium/glucose cotransporter), member 2
Synonyms: Sglt2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 246787
Homologene: 2289
Dnah5
Name: dynein, axonemal, heavy chain 5
Synonyms: Mdnah5, b2b1154Clo, b2b1134Clo, b2b1537Clo, b2b1565Clo, Dnahc5, b2b3491Clo
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 110082
HGNC: HGNC:2950
Homologene: 1048
Pcdh7
Name: protocadherin 7
Synonyms: BH-protocadherin
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 54216
HGNC: HGNC:8659
Homologene: 36101
Lama4
Name: laminin, alpha 4
Synonyms: laminin [a]4
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16775
HGNC: HGNC:6484
Homologene: 37604
Mlycd
Name: malonyl-CoA decarboxylase
Synonyms: Mcd
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 56690
HGNC: HGNC:7150
Homologene: 40821
Cacna1s
Name: calcium channel, voltage-dependent, L type, alpha 1S subunit
Synonyms: Cchl1a3, fmd, mdg, sj, muscle dysgenesis, Cav1.1, DHPR alpha1s
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12292
HGNC: HGNC:1397
Homologene: 37257
Sos2
Name: SOS Ras/Rho guanine nucleotide exchange factor 2
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 20663
Homologene: 38253
Odad4
Name: outer dynein arm complex subunit 4
Synonyms: 4933404O19Rik, Ttc25
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74407
Homologene: 12860
Myh3
Name: myosin, heavy polypeptide 3, skeletal muscle, embryonic
Synonyms: MyHC-emb, Myhs-e, Myhse
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17883
HGNC: HGNC:7573
Homologene: 20553
Atg4b
Name: autophagy related 4B, cysteine peptidase
Synonyms: Apg4b, 2510009N07Rik, autophagin 1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 66615
Homologene: 100868
Cyp2d11
Name: cytochrome P450, family 2, subfamily d, polypeptide 11
Synonyms: Cyp2d, P450-2D
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 545123
VEGA: 15
Homologene: 86099
Zfp93
Name: zinc finger protein 93
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22755
Homologene: 117959
Tcaf1
Name: TRPM8 channel-associated factor 1
Synonyms: A230020K05Rik, 2810407D09Rik, 3321401G04Rik, Fam115a
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 77574
Homologene: 8815
Cyp2g1
Name: cytochrome P450, family 2, subfamily g, polypeptide 1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13108
HGNC: HGNC:2633
Homologene: 75020
Man2a2
Name: mannosidase 2, alpha 2
Synonyms: alpha mannosidase IIx, MX, 4931438M07Rik, 1700052O22Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 140481
HGNC: HGNC:6825
Homologene: 55954
Ccdc188
Name: coiled-coil domain containing 188
Synonyms: Gm7873
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 102638083
VEGA: 16
Homologene: 90442
Mcmdc2
Name: minichromosome maintenance domain containing 2
Synonyms: 6030422M02Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240697
Homologene: 18309
Spata1
Name: spermatogenesis associated 1
Synonyms: SP-2, 4921536I21Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 70951
Homologene: 23356
Tle6
Name: transducin-like enhancer of split 6
Synonyms: Grg6, 1810057E06Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 114606
Homologene: 11701
Or1e1f
Name: olfactory receptor family 1 subfamily E member 1F
Synonyms: GA_x6K02T2P1NL-4121434-4122381, MOR135-28, Olfr397
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258343
Homologene: 138309
Zfp474
Name: zinc finger protein 474
Synonyms: 4933409D10Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 66758
Homologene: 12027
Malrd1
Name: MAM and LDL receptor class A domain containing 1
Synonyms: Diet1, Gm13318, Gm13364
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 102635496
Homologene: 136214
Mup20
Name: major urinary protein 20
Synonyms: darcin
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 381530
Homologene: 74304
A230046K03Rik
Name:
Type: Gene
Species: Mouse
Chromosome: 10
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 9,916,642 bp
  • T to A, chromosome 1 at 93,785,972 bp
  • A to T, chromosome 1 at 136,077,692 bp
  • A to G, chromosome 1 at 179,610,194 bp
  • T to A, chromosome 1 at 189,682,403 bp
  • A to G, chromosome 2 at 15,925,120 bp
  • CT to CTT, chromosome 2 at 26,327,352 bp
  • C to T, chromosome 2 at 28,078,318 bp
  • T to C, chromosome 2 at 158,613,841 bp
  • T to A, chromosome 3 at 89,052,755 bp
  • G to T, chromosome 3 at 146,489,859 bp
  • T to C, chromosome 4 at 62,053,484 bp
  • A to G, chromosome 4 at 133,613,854 bp
  • T to C, chromosome 4 at 134,134,089 bp
  • A to T, chromosome 5 at 57,720,336 bp
  • T to C, chromosome 6 at 42,675,302 bp
  • A to T, chromosome 6 at 91,740,971 bp
  • A to G, chromosome 7 at 24,276,054 bp
  • A to G, chromosome 7 at 26,814,734 bp
  • T to C, chromosome 7 at 30,023,333 bp
  • T to C, chromosome 7 at 80,361,018 bp
  • C to A, chromosome 7 at 99,926,444 bp
  • T to A, chromosome 7 at 103,418,200 bp
  • C to T, chromosome 7 at 127,539,197 bp
  • T to C, chromosome 7 at 128,271,156 bp
  • G to T, chromosome 7 at 141,704,252 bp
  • A to T, chromosome 8 at 119,407,593 bp
  • T to C, chromosome 9 at 20,500,314 bp
  • A to T, chromosome 9 at 31,131,625 bp
  • A to G, chromosome 9 at 72,686,107 bp
  • T to G, chromosome 9 at 86,755,613 bp
  • G to A, chromosome 9 at 108,692,511 bp
  • A to G, chromosome 10 at 39,078,720 bp
  • T to A, chromosome 10 at 58,455,925 bp
  • A to G, chromosome 10 at 81,591,054 bp
  • A to G, chromosome 10 at 83,580,299 bp
  • A to G, chromosome 11 at 67,092,002 bp
  • A to T, chromosome 11 at 73,965,414 bp
  • G to A, chromosome 11 at 100,563,676 bp
  • A to G, chromosome 11 at 103,395,060 bp
  • A to C, chromosome 12 at 69,598,824 bp
  • T to A, chromosome 12 at 71,060,115 bp
  • T to C, chromosome 12 at 111,592,683 bp
  • A to T, chromosome 14 at 33,382,284 bp
  • G to A, chromosome 14 at 36,896,263 bp
  • A to G, chromosome 15 at 28,453,268 bp
  • ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT to ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT, chromosome 15 at 76,002,775 bp
  • G to T, chromosome 15 at 82,390,437 bp
  • A to G, chromosome 16 at 18,218,380 bp
  • T to C, chromosome 17 at 12,922,734 bp
  • G to A, chromosome 17 at 17,374,475 bp
  • A to T, chromosome 17 at 45,633,399 bp
  • A to T, chromosome 18 at 52,639,157 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8194 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067617-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.


Title

Text